Research Article |
|
Corresponding author: Yander L. Diez ( yanderluis87@gmail.com ) Academic editor: Danilo Harms
© 2024 Yander L. Diez, Andreas Schmidt-Rhaesa.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Diez YL, Schmidt-Rhaesa A (2024) Little neighbours in Hamburg: free-living aquatic flatworms (Platyhelminthes). Evolutionary Systematics 8(2): 279-310. https://doi.org/10.3897/evolsyst.8.139468
|
Free-living flatworms, also known as turbellarians, are abundant and key components of aquatic habitats. They play vital roles in food webs and contribute to ecosystem health. However, our understanding of their diversity remains limited, even from comparably well-studied regions of Europe. In this work, we summarise the available records on aquatic turbellarians from Hamburg, Germany, provide new records based on material obtained during exploratory collecting, and place selected species in a molecular phylogenetic context. We sampled four localities in Hamburg, two urban and two suburban, and three other localities in Germany and Switzerland, collecting submerged vegetation, litter, and mosses. Prior to our investigation, Hamburg had documented 26 species of aquatic turbellarians. Our collections have led to the first recorded instances of Stenostomum gotlandense and Castrella alba in Germany, along with four new species for Hamburg: Macrostomum rostratum, Microdalyellia schmidtii, Krumbachia hiemalis, and Polycelis tenuis. Additionally, we provide updated information for five species previously recorded from Hamburg: S. leucops, Prorhynchus stagnalis, Microdalyellia armigera, Gyratrix hermaphroditus, and Planaria torva. The phylogenetic analysis revealed cryptic diversity within S. grande and S. leucops, with S. grande comprising two distinct clades (Brazil and Japan + Germany), and S. leucops consisting of four clades (Sweden + Germany, two from Finland, and Brazil). One of the Finnish clades, S. leucops aquariorum, is both morphologically and molecularly distinct, and we recognise it as a valid species, now S. aquariorum. Future research is needed to further clarify the relationships of the remaining clades of these two species, particularly with material from their type localities in the United States. Among rhabdocoel microturbellarians, we identified cryptic diversity within Castrella truncata (with European and North American lineages) and Microdalyellia armigera (encompassing Finnish and Spanish lineages). We also provided the first molecular evidence supporting the monophyly of Krumbachia following the sequencing of K. hiemalis. Conversely, species of Bothromesostoma were found to be nested within a clade containing species of Mesostoma, leading us to propose synonymising these genera. Overall, our study underscores the rich biodiversity potential of urban and suburban ecosystems for detecting freshwater turbellarian species, while highlighting the need for further research in Hamburg and across Germany to clarify species distributions. Moreover, molecular phylogenetic analyses have uncovered cryptic diversity in several species of catenulids and rhabdocoels, emphasizing the importance of future efforts to describe potential new species.
Catenulida, cryptic diversity, Macrostomorpha, Prorhynchida, Proseriata, Rhabdocoela, Tricladida, turbellarian, urban biodiversity
Free-living flatworms (Platyhelminthes) represent a fascinating yet understudied component of freshwater and terrestrial ecosystems worldwide. Their diverse morphologies, behaviours, and ecological roles render them invaluable subjects for understanding fundamental principles of biodiversity and ecosystem functioning (
In Germany, with its strong focus on biodiversity documentation and conservation efforts, the exploration of free-living flatworm diversity holds particular significance. The free-living flatworm fauna of Germany is, by far, the best studied worldwide since several classical taxonomists working on free-living flatworms were based in these regions. More than 400 species have been recorded from this country (
Germany’s diverse array of habitats, ranging from pristine mountain streams to urbanized landscapes (
In this paper, we aim to synthesize existing knowledge on the free-living, aquatic flatworms from Hamburg, Germany. We record for the first time two species new to Germany and four species new to Hamburg, and provide new information for five species previously recorded to Hamburg. Finally, we reconstructed the molecular phylogenetic relationships for selected species of Catenulida and Rhabdocoela.
The current research started with the revision of the available literature documenting the free-living, aquatic flatworms from Hamburg (see Table
Checklist of the freshwater turbellarians from Hamburg, Germany, including new records.
| Group | Species | Localities | Habitat | References |
|---|---|---|---|---|
| Catenulida | Rhynchoscolex simplex Leidy, 1852 | Elbe river, Hamburg Harbor (Köhlbrand) | medium sand with little detritus |
|
| detritus-free medium sand |
|
|||
| Elbe river, Bank near Hamburg | - |
|
||
| Stenostomum ciliatum Kepner & Carter, 1931 | Elbe river | littoral |
|
|
| Stenostomum gotlandense Larssson & Willems, 2010 | Kirchwerder-Fünfhausen | submerged vegetation and litter | This study | |
| Stenostomum grabbskogense Luther, 1960 | Elbe river, Krauel | muddy substrates covered with algae |
|
|
| Stenostomum leucops (Duges, 1828) Schmidt, 1848 | Elbe river | littoral |
|
|
| Kirchwerder-Fünfhausen | submerged vegetation and litter | This study | ||
| Macrostomorpha | Microstomum lineare (Müller, 1773) Schmidt, 1848 | Elbe river, Krauel | muddy substrates covered with algae |
|
| Elbe river | littoral |
|
||
| Macrostomum rostratum Papi, 1959 | Wandse river | vegetation with organic matter, 0.1 m deep | This study | |
| Macrostomum hystrix Ørsted, 1843 | Elbe river | littoral |
|
|
| Tricladida | Dendrocoelum lacteum (Müller, 1774) Ørsted, 1844 | Außen- and Binnenalster | - |
|
| Elbe river | littoral |
|
||
| Planaria torva (Müller, 1773) Müller, 1776 | Außen- and Binnenalster | littoral |
|
|
| Elbe river | littoral |
|
||
| Wandse river | vegetation with organic matter, 0.1 m deep | This study | ||
| Planten un Blomen park | rotten vegetation, 0.2 m deep | This study | ||
| Polycelis nigra (Müller, 1774) Ehrenberg, 1831 | Elbe river | littoral |
|
|
| Polycelis tenuis Ijima, 1884 | Kirchwerder-Fünfhausen | submerged vegetation and litter | This study | |
| Proseriata | Boreusyrtis neiswestnovae (Riemann, 1965) Lukhnev, Koroleva, Kirilchik & Timoshkin, 2017 | Elbe river, near Hamburg-Harburg | muddy substrate, 2–8 m deep |
|
| Coelogynopora schulzii Meixner, 1938 | Elbe river, near Hamburg-Harburg | sandy beach, intertidal |
|
|
| Paramonotus hamatus (Jensen, 1878) Meixner, 1938 | Elbe river, near Hamburg-Harburg | sandy beach, intertidal |
|
|
| Hamburg Harbour | intertidal, detritus-free medium sand |
|
||
| subtidal, muddy substrate |
|
|||
| Pseudosyrtis subterranea (Ax, 1951) Ax, 1956 | Elbe river, near Hamburg-Harburg | sandy beach, intertidal |
|
|
| Prolecithophora | Plagiostomum lemani Forel & Du Plessis, 1874 | Elbe river | littoral |
|
| Prorhynchida | Prorhynchus stagnalis Schultze, 1851 | Elbe river | littoral |
|
| Kirchwerder-Fünfhausen | submerged vegetation and litter | This study | ||
| Rhabdocoela | Baicalellia brevituba (Luther, 1918) Nasonov, 1930 | Elbe river, Krauel | muddy substrates covered with algae |
|
| Castrella alba Luther, 1955 | Kirchwerder-Fünfhausen | submerged vegetation and litter | This study | |
| Microdalyellia armigera (Schmidt, 1862) Gieysztor, 1938 | Elbe river | littoral |
|
|
| Wandse river | vegetation with organic matter, 0.1 m deep | This study | ||
| Microdalyellia schmidtii (Graff, 1882) Gieysztor, 1938 | Wittenberg, Rissen | tree holes filled with water, 20–50 cm over the ground level | This study | |
| Phaenocora gracilis (Vejdovsky, 1895) Graff, 1909 | Elbe river | littoral |
|
|
| Phaenocora typhlops (Vejdovsky, 1880) Hofsten, 1907 | Elbe river, Krauel | muddy substrates covered with algae |
|
|
| Phaenocora unipunctata (Ørsted, 1843) Bendl, 1908 | Elbe river | littoral |
|
|
| Olisthanella truncula (Schmidt, 1858) Voigt, 1892 | Elbe river | littoral |
|
|
| Mesostoma ehrenbergii (Focke, 1836) Örsted, 1843 | Elbe river | littoral |
|
|
| Mesostoma lingua (Abildgaard, 1789) Schmidt, 1848 | Elbe river | littoral |
|
|
| Mesostoma tetragonum (Müller, 1774) Schmidt, 1848 | Elbe river | littoral |
|
|
| Krumbachia hiemalis Schwank, 1979 | Wittenberg, Rissen | tree holes filled with water, 20–50 cm over the ground level | This study | |
| Gyratrix hermaphroditus Ehrenberg, 1830 | Elbe river, near Hamburg-Harburg | sandy beach, intertidal |
|
|
| Elbe river | littoral |
|
||
| Wandse river | vegetation with organic matter, 0.1 m deep | This study | ||
| Kirchwerder-Fünfhausen | submerged vegetation and litter | This study | ||
| Placorhynchus dimorphis Karling, 1947 | Elbe river Krauel | muddy substrates covered with algae |
|
Additional samplings, in order to collect relevant material for molecular analyses, were conducted in Switzerland: Röserental, Basel (47°29'35.0"N, 07°41'37.8"E) (April 12, 2024), and other German localities: Groß Glienicker lake, Brandenburg (52°28'25.7"N, 13°06'57.6"E) (March 26, 2024); and near List, Sylt (55°02'03.1"N, 08°25'07.8"E) (June 24, 2024).
The flatworms were extracted by oxygen depletion (
Total DNA of selected taxa was extracted using a protocol for low-input tissues (
For the selected specimens (Catenulida and Rhabdocoela), we amplified partial sequences of the 18S and 28S ribosomal DNA genes (rDNA). Additionally, for catenulids a fragment of the COI mitochondrial DNA gene (mDNA) was also amplified. Amplification primers and protocols varied according to the taxa (Catenulida or Rhabdocoela) (Table
| Primer | Direction | Primer sequence (5’-3’) | Reference |
|---|---|---|---|
| Rhabdocoela subunit 18S | |||
| TimA | Forward | AMCTG GTT GAT CCT GCCAG | Willems et al. (2006) |
| TimB | Reverse | TGATCCATCTGCAGGTTCACCT | Willems et al. (2006) |
| 95 °C * 5 min 10 s, 30X (94 °C * 30 s, 55 °C * 30 s, 72 °C * 90 s), 72 °C * 5 min | |||
| Rhabdocoela subunit 28S | |||
| LSU5 | Forward | TAG GTC GAC CCG CTG AAY TTA | Van Steenkiste et al. (2013) |
| LSU6-3B | Reverse | GAG AAG GGT TCC ATG TGA ACAGC | Van Steenkiste et al. (2013) |
| 95 °C * 5 min 10 s, 30X (94 °C * 60 s, 50 °C * 60 s, 72 °C * 90 s), 72 °C * 5 min | |||
| Catenulida subunit 18S | |||
| U95947-0025 | Forward | CATATGCTTGTCTCAAAG | Yamasaki et al. 2012 |
| U95947-1788 | Reverse | GGAAACCTTGTTACGACT | Yamasaki et al. 2012 |
| 94 °C * 3 min, 35X (94 °C * 1 min, 50 °C * 1 min, 72 °C * 2 min), 72 °C * 8 min | |||
| Catenulida subunit 28S | |||
| LSU5 | Forward | TAG GTC GAC CCG CTG AAY TTA | Larsson and Jondelius 2008 |
| L1642R | Reverse | CCAGCGCCATCCATTTTCA | Larsson and Jondelius 2008 |
| 94 °C * 3 min, 38X (94 °C * 30 s, 50 °C * 30 s, 72 °C * 30 s), 72 °C * 5 min | |||
| Catenulida subunit COI | |||
| COI5B | Forward | TTCTGRTTYTTYGGNCAY CC |
|
| COI3B | Reverse | AAGTGTTGNGGRARAANGT |
|
| 95 °C * 5 min, 30X (94 °C * 1 min, 50 °C * 1 min, 72 °C * 1 min), 72 °C * 3 min | |||
Obtained contigs were quality-trimmed (error probability = 0.05) and assembled in Geneious Prime v2025.0 (Kearse et al. 2012). Consensus sequences were subjected to a BLAST search (
GenBank accession numbers of Catenulida used in the study (*new sequences).
| Species | 18S rDNA | 28S rDNA | COI | Distribution |
|---|---|---|---|---|
| Stenostomum arevaloi K04_53 | FJ384808 | FJ384847 | FJ384889 | Sweden |
| S. arevaloi K04_80 | FJ384810 | FJ384849 | FJ384895 | Sweden |
| S. arevaloi K05_60 | FJ384833 | FJ384871 | FJ384910 | Sweden |
| S. bryophilum K04_09 | FJ384799 | FJ384836 | FJ384875 | Sweden |
| S. bryophilum K04_30 | FJ196320 | FJ384843 | FJ384882 | Sweden |
| S. bryophilum K04_49 | – | FJ384845 | FJ384888 | Sweden |
| S. bryophilum K04_71 | FJ196333 | FJ196343 | FJ384892 | Sweden |
| S. bryophilum K04_78 | FJ196334 | – | FJ384894 | Sweden |
| S. gotlandense K04_81 | FJ384811 | FJ384850 | FJ384896 | Sweden |
| S. gotlandense K04_90 | – | FJ384855 | FJ384900 | Sweden |
| S. gotlandense K04_93 | – | FJ384856 | FJ384901 | Sweden |
| S. gotlandense K04_94 | – | – | FJ384902 | Sweden |
| S. gotlandense D-259 | *PQ722290 | *PQ722307 | *PQ687017 | Hamburg, Germany |
| S. grabbskogense K04_06 | FJ196326 | FJ196337 | FJ384874 | Sweden |
| S. grabbskogense K04_11 | FJ196327 | FJ196338 | FJ384876 | Sweden |
| S. grabbskogense K04_12 | – | FJ384838 | FJ384877 | Sweden |
| S. grabbskogense K04_15 | – | FJ384839 | FJ384878 | Sweden |
| S. grabbskogense K04_19 | FJ384801 | FJ384841 | FJ384880 | Sweden |
| S. grabbskogense K05_27 | FJ384827 | FJ384867 | FJ384907 | Sweden |
| S. grande | – | – | KM056359 | Brazil |
| S. grande | AB665104 | – | AB665116 | Japan |
| Stenostomum sp. G-11 | *PQ722293 | *PQ722310 | – | Brandenburg, Germany |
| Stenostomum sp. G-12 | *PQ722294 | *PQ722311 | – | Brandenburg, Germany |
| Stenostomum sp. S-260 | *PQ722296 | *PQ722313 | – | Sylt, Germany |
| S. handoelense K05_17 | FJ384823 | FJ384864 | FJ384905 | Sweden |
| S. handoelense K05_20 | FJ384824 | FJ384865 | FJ384906 | Sweden |
| S. heebuktense K04_45A | FJ196330 | – | FJ384887 | Sweden |
| S. leucops | – | – | KJ476143 | Brazil |
| S. leucops AJ405976 | – | – | AJ405976 | Finland |
| S. leucops D-229 | *PQ722295 | *PQ722312 | – | Sylt, Germany |
| S. leucops D-257 | *PQ722291 | *PQ722308 | – | Hamburg, Germany |
| S. leucops D-258 | *PQ722292 | *PQ722309 | – | Hamburg, Germany |
| S. leucops K04_18 | FJ384800 | FJ384840 | FJ384879 | Sweden |
| S. leucops K04_29 | FJ384804 | FJ384842 | FJ384881 | Sweden |
| S. leucops K04_63A | – | – | FJ384891 | Sweden |
| S. leucops K04_75 | FJ384809 | FJ384848 | FJ384893 | Sweden |
| S. leucops K04_85 | FJ384812 | FJ384852 | FJ384898 | Sweden |
| S. leucops K04_87 | FJ384813 | FJ384853 | FJ384899 | Sweden |
| S. leucops K05_51 | FJ384830 | FJ384869 | FJ384908 | Sweden |
| S. leucops K05_55 | FJ384832 | FJ384870 | FJ384909 | Sweden |
| S. leucops aquariorum AJ012519 | AJ012519 | – | – | Finland |
| S. saliens 1 | AB665114 | – | AB665123 | Japan |
| S. saliens 2 | AB665115 | – | AB665124 | Japan |
| S. simplex 1 | AB665105 | – | AB665117 | Japan |
| S. simplex 2 | AB665107 | – | AB665118 | Japan |
| S. simplex 3 | AB665109 | – | AB665119 | Japan |
| S. simplex 4 | AB665110 | – | AB665120 | Japan |
| S. simplex S-227 | – | – | *PQ687018 | Sylt, Germany |
| S. sphagnetorum K04_01 | FJ384797 | – | FJ384873 | Sweden |
| S. sphagnetorum K05_07 | FJ384818 | FJ384860 | FJ384904 | Sweden |
| S. steveoi K04_59 | FJ196331 | – | FJ384890 | Sweden |
| S. steveoi K04_84 | – | FJ384851 | FJ384897 | Sweden |
| S. tuberculosum 1 | – | – | AB665121 | Japan |
| S. tuberculosum 2 | – | – | AB665122 | Japan |
| S. tuberculosum 3 | AB665112 | – | – | Japan |
| S. tuberculosum 4 | AB665113 | – | – | Japan |
| Catenula turgida K04_32 | FJ384805 | FJ196339 | FJ384883 | Sweden |
| Rhynchoscolex simplex K04_41 | FJ384806 | FJ384844 | FJ384885 | Sweden |
GenBank accession numbers of Rhabdocoela used in the study (*new sequences).
| Species | 18S rDNA | 28S rDNA |
|---|---|---|
| Acrochordonoposthia conica | KC529487 | KC529617 |
| Bothromesostoma personatum | KC529501 | – |
| Bothromesostoma personatum | M58347 | – |
| Bothromesostoma sp. | D85098 | – |
| Bryoplana xerophila | KC529489 | KC529619 |
| Carcharodopharynx sp. | KC529481 | KC529612 |
| Castrada hofmanni | KC529496 | – |
| Castrada intermedia | KC529497 | – |
| Castrada lanceola | AY775751 | – |
| Castrada luteola | AY775752 | – |
| Castrada neocomensis | KC529498 | – |
| Castrada viridis | AY775753 | – |
| Castrella alba D-282 | *PQ722297 | *PQ722314 |
| Castrella alba D-283 | *PQ722298 | *PQ722315 |
| Castrella alba G-29 | *PQ722299 | PQ722316 |
| Castrella pinguis | KC529438 | KC529569 |
| Castrella truncata | AY775777 | KC529570 |
| Castrella truncata Switzerland B-21 | *PQ722300 | *PQ722317 |
| Dalyellia tatrica | KC529443 | KC529574 |
| Dalyellia viridis | KC529444 | KC529575 |
| Dalyelliidae n. gen. n. sp. | KC529441 | – |
| Dochmiotrema limicola | KC529495 | KC529624 |
| Dochmiotrema sp. | PP723168 | PP723167 |
| Gieysztoria acariaia | KC529470 | KC529601 |
| Gieysztoria ashokae | KC529466 | KC529597 |
| Gieysztoria beltrani | KC529475 | KC529606 |
| Gieysztoria cf. billabongensis | KC529442 | KC529573 |
| Gieysztoria cf. cuspidata | KC529457 | KC529588 |
| Gieysztoria choctaw | KC529476 | KC529607 |
| Gieysztoria complicata | KC529473 | KC529604 |
| Gieysztoria cuspidata | KC529458 | KC529589 |
| Gieysztoria dodgei | KC529479 | KC529610 |
| Gieysztoria garudae | KC529467 | KC529598 |
| Gieysztoria iberica | KC529461 | KC529592 |
| Gieysztoria infundibuliformis | KC529468 | KC529599 |
| Gieysztoria knipovici | KC529463 | – |
| Gieysztoria ornata | KC529460 | KC529591 |
| Gieysztoria pavimentata | KC529472 | KC529603 |
| Gieysztoria rubra | KC529480 | KC529611 |
| Gieysztoria sp. n. 1 scissors | KC529454 | KC529585 |
| Gieysztoria sp. n. 2 spine | KC529455 | KC529586 |
| Gieysztoria sp. n. 3 aberrant | KC529456 | KC529587 |
| Gieysztoria sp. n. 4 indian | KC529464 | KC529595 |
| Gieysztoria sp. n. 5 red | KC529469 | KC529600 |
| Gieysztoria sp. n. 6 ‘brown’ | KC529474 | KC529605 |
| Gieysztoria sp. n. 7 hooklet | KC529477 | KC529608 |
| Gieysztoria sp. n. 8 sardinia | KC529462 | KC529593 |
| Gieysztoria sp. par YG 2018 | MG820105.2 | MG820107.2 |
| Gieysztoria sp. pel YG 2018 | MG820112 | MG820115 |
| Gieysztoria sp. ZCX 2012_1 | JQ999991 | – |
| Gieysztoria sp. ZCX 2012_2 | JQ999992 | – |
| Gieysztoria sp. ZXY 2011 | HQ993097 | – |
| Gieysztoria triquetra | KC529478 | KC529609 |
| Gieysztoria zuluensis | KC529465 | KC529596 |
| Krumbachia sp. | KC529488 | KC529618 |
| Krumbachia hiemalis D-159 | *PQ722301 | *PQ722322 |
| Krumbachia hiemalis D-160 | *PQ722302 | *PQ722323 |
| Mesocastrada sp. | U70081 | – |
| Mesostoma lingua | AY775759 | KC529626 |
| Mesostoma lingua AY775759 | AY775759 | – |
| Mesostoma lingua KC529626 | – | KC529626 |
| Mesostoma lingua AJ243682 | AJ243682 | – |
| Mesostoma thamagae | AY775760 | – |
| Microdalyellia armigera Finland | KC529451 | KC529582 |
| Microdalyellia armigera Spain | KC529452 | KC529583 |
| Microdalyellia brevispina | KC529450 | KC529581 |
| Microdalyellia fairchildi | KC529447 | KC529578 |
| Microdalyellia fusca | KC529453 | KC529584 |
| Microdalyellia kupelwieseri Switzerland B-11 | *PQ722303 | *PQ722320 |
| Microdalyellia kupelwieseri Switzerland B-12 | *PQ722304 | *PQ722321 |
| Microdalyellia nanella | KC529449 | KC529580 |
| Microdalyellia picta | KC529446 | KC529577 |
| Microdalyellia rossi | KC529448 | KC529579 |
| Microdalyellia schmidtii Belgium | KC529445 | KC529576 |
| Microdalyellia schmidtii Hamburg D-156 | *PQ722305 | *PQ722318 |
| Microdalyellia schmidtii Hamburg D-158 | *PQ722306 | *PQ722319 |
| Microdalyellia sinensis | JF429837 | – |
| Microdalyellia sp. ZXY 2011 | HQ993095 | – |
| Olisthanella truncula | KC529494 | KC529623 |
| Olisthanella truncula AY775761 | AY775761 | – |
| Opistomum arsenii | KC529491 | KC529620 |
| Phaenocora foliacea | KC529492 | KC529621 |
| Phaenocora shenda PHE1-18 | ON843455 | ON843453 |
| Phaenocora shenda PHE2-18 | ON843456 | ON843454 |
| Phaenocora sp. n. | KC529493 | KC529622 |
| Phaenocora unipunctata | AY775762 | – |
| Protoplanella simplex | KC529490 | – |
| Pseudodalyellia alabamensis | KC529440 | KC529571 |
| Rhynchomesostoma rostratum | KC529499 | KC529625 |
| Rhynchomesostoma rostratum UH77.15 | KC529500 | – |
| Strongylostoma devleeschouweri | KC529486 | – |
| Strongylostoma elongatum | AY775771 | – |
| Strongylostoma elongatum spinosum | KC869830 | KC869883 |
| Strongylostoma radiatum | KC529485 | KC529616 |
| Typhloplana viridata | KC529484 | KC529615 |
| Grappleria corona | MW052803 | MW052802 |
| Halammovortex sp. | KC529437 | KC529567 |
| Temnocephala fasciata | KC869834 | KC869888 |
| Temnosewellia minor | AY157183 | AY157164 |
Best-fitting partitions and substitution models used in the phylogenetic analyses, as calculated in ModelFinder (
| Dataset | Partition scheme | Substitution model | MrBayes friendly model |
|---|---|---|---|
| Rhabdocoela | 18S, 28S rDNA | GTR+F+I+G4 | GTR+F+I+G4 |
| Catenulida | 18S rDNA | TIMe+G4 | SYM+G4 |
| 28S rDNA | TIM+F+G4 | GTR+F+G4 | |
| 1st and 2nd codon positions of COI | GTR+F+I+G4 | GTR+F+I+G4 | |
| 3rd codon positions of COI | TIM+F+G4 | GTR+F+I+G4 |
Ribosomal datasets were aligned using MAFFT v7, as implemented in Geneious (
Maximum likelihood (ML) analyses were conducted using the ‘Tree Inference’ tool on the IQ-TREE server (
The literature review revealed the presence of 26 species of aquatic turbellarians previously documented in Hamburg (Table
Based on our collected material, the catenulid Stenostomum gotlandense Larsson & Willems, 2010 and the rhabdocoel Castrella alba Luther, 1955 are recorded for the first time from Germany. Four species are recorded for the first time from Hamburg: Macrostomum rostratum Papi, 1959, Microdalyellia schmidtii (Graff, 1882) Gieysztor, 1938, Krumbachia hiemalis Schwank, 1979, and Polycelis tenuis Ijima, 1884. Five known species, previously recorded to Hamburg were also collected during our field work: Stenostomum leucops (Duges, 1828) Schmidt, 1848, Prorhynchus stagnalis Schultze, 1851, Gyratrix hermaphroditus Ehrenberg, 1831, Microdalyellia armigera (Schmidt, 1862) Gieysztor, 1938, and Planaria torva (Müller, 1773). Considering our findings, the current number of aquatic turbellarians known from Hamburg is 31 species.
Platyhelminthes Minot, 1876
Catenulida Meixner, 1924
Stenostomidae Vejdovsky, 1880
Stenostomum Schmidt, 1848
Species only known, until now, from Gotland, Sweden (
Two specimens studied alive and stored in absolute ethanol for molecular analyses, one of them sequenced; collected in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep.
Specimens measuring 768–957 µm long (x̄ = 863 µm; n = 2) and 90–110 µm at widest point (x̄ = 100 µm; n = 2), with two zooids, slender, tapering to both rounded extremes (Fig.
Stenostomum gotlandense. A. Habitus of a swimming specimen; B. Anterior part of the body; C. Anterior part of the body showing the brain; D. Posterior part of the body. Abbreviations: ab anterior brain; br brain; cp ciliated pits; ep excretophore; i intestine; m mouth; pb posterior brain; ph pharynx; pn protonephridia. Scale bars: 50 μm (A, C); 100 μm (B, D).
As noted by
Species with a broad distribution through North America (United States and Mexico) (
Three specimens studied alive and stored in absolute ethanol; collected in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep. Three specimens studied alive and stored in absolute ethanol; collected in Groß Glienicker lake, littoral, floating vegetation. Three specimens studied alive and stored in absolute ethanol; collected in Sylt, floating vegetation in a small pond. Two specimens from Kirchwerder-Fünfhausen and one from Sylt were sequenced for the molecular analyses.
Specimens measuring 1120–1490 µm long (x̄ = 1305 µm; n = 2) and 175–220 µm at widest point (x̄ = 198 µm; n = 2), with two zooids, anterior end rounded and posterior tapering (Fig.
Stenostomum leucops. A–C Habitus of swimming specimens; D. Anterior part of the body; E. Posterior part of the body F, G. Anterior part of the body. Abbreviations: ab anterior brain; br brain; cp ciliated pits; i intestine; m mouth; np nephridiopore; pb posterior brain; ph pharynx; phg pharyngeal glands. Scale bars: 200 μm (A–C); 100 μm (D, E); 50 μm (F, G).
Our identification of specimens was primarily based on
Given that the type locality of S. leucops is in the vicinity of New York, United States, a comprehensive morphological and molecular phylogenetic analysis of specimens from that area is essential to stabilize the classification of S. leucops (see Discussion).
Macrostomorpha Doe, 1986
Macrostomidae Beneden, 1870
Macrostomum Schmidt, 1848
Species with a broad known distribution including Europe (United Kingdom, The Netherlands, Germany, Finland, Spain, and Italy) (
Two specimens studied alive, one preserved in ethanol for future molecular analyses, the second cut in two pieces, the posterior part containing the stylet for whole mounting and the anterior part preserved for molecular analyses. Collected in Wandse river, submerged vegetation with organic matter, 0.1 m deep.
Description. Animals 0.8–0.9 mm long (n = 2), unpigmented and with a pair of eyes (Fig.
Macrostomum rostratum. A. Habitus of a swimming specimen; B. Anterior part of the body; C–F. Posterior part of the body. Abbreviations: e eye; eg egg; ph pharynx; pv prostate vesicle; st stylet; sv seminal vesicle. Scale bars: 200 μm (A); 50 μm (B–F).
According to the drawings of
Prorhynchidae Hallez, 1894
Prorhynchus Schultze, 1851
Species with a worldwide distribution, recorded from South America (Brazil) (
Six specimens studied alive, two preserved in ethanol for future molecular analyses, four cut in two pieces, the anterior part containing the stylet for whole mounting (ZMH V13839–13842) and the posterior part preserved for molecular analyses; collected in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep.
Animals 2.5–3.5 mm long depending on the contraction stage, opaque, without eyes (Fig.
Prorhynchus stagnalis. A. Habitus of a swimming specimen; B–D. Anterior part of the body; E, F. Sclerotised structures. Abbreviations: br brain; eb external bars; i intestine; ib internal bars; ov ovary; ph pharynx; phg pharyngeal glands; pv prostate vesicle; st stylet. Scale bars: 200 μm (A); 100 μm (B–D); 50 μm (E, F).
The ovary (Fig.
The armed male copulatory organ (Fig.
It has been proposed that P. stagnalis comprises a complex of species primarily distinguished by variations in the morphology of male sclerotised structures. However, comprehensive morphological and molecular investigations are imperative to elucidate the taxonomy of this species group fully. Furthermore, extensive sampling is required, including the type locality of the species (Greifswald, Germany). The specimens we have examined exhibit the smallest stylet (~66 µm) compared to those documented in the literature from The Urals (100–124 µm; Rogozin 2015), the United States (~90 µm;
Kalyptorhynchia Graff, 1905
Eukalyptorhynchia Meixner, 1928
Polycystididae Graff, 1905
Gyratrix Ehrenberg, 1831
This is the microturbellarian species with the widest distribution worldwide (see
Specimens were found in two locations. One specimen was studied alive and preserved in ethanol for future molecular analyses. It was collected in Wandse river, submerged vegetation with organic matter, 0.1 m deep. Fifteen specimens were studied alive, eleven of them whole mounted and four preserved for future molecular analyses collected in Kirchwerder-Fünfhausen, among submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep.
The specimen from Wandse river is 1354 µm long and those from Kirchwerder-Fünfhausen are 870–926 µm long (x̄ = 904 µm; n = 6). They are unpigmented, with a pair of eyes (Fig.
Gyratrix hermaphroditus. A, B. Habitus of a swimming specimen; C–F. Posterior part with sclerotised structures. Abbreviations: b bursa; e eye; ov ovary; ph pharynx; pr proboscis; ps3, ps4 prostate stylet type 3 and 4, respectively; pv prostate vesicle; t testi. Scale bars: 100 μm (A); 50 μm (B–F).
The testis (Fig.
Vitellarium not observed. The ovary (Fig.
Based on our findings, it appears that the specimens collected from the two sampled localities correspond to two distinct species within the G. hermaphroditus complex. These species are distinguishable by differences in the size of the sclerotised male structures and the morphology of the ovary. However, differentiation within this extensive species complex poses significant challenges and warrants molecular investigations. Phylogenetic analyses conducted by
The morphology of the hard structures in our specimens appears to align with group H as defined by
Neotyphloplanida Willems, Wallberg, Jondelius, Littlewood, Backeljau, Schockaert & Artois, 2006
Limnotyphloplanida Van Steenkiste, Tessens, Willems, Backeljau, Jondelius & Artois, 2013
Dalyelliidae Graff, 1905
Castrella Graff, 1905
Species recorded from Finland and Sweden (
Seven specimens studied alive, two of which were whole mounted afterwards (ZMH V13831–13832); collected in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep. Four specimens studied alive and preserved in absolute ethanol, collected in Groß Glienicker lake; littoral, floating vegetation. Two specimens from Kirchwerder-Fünfhausen and one from Groß Glienicker lake used for molecular phylogenetic analyses.
Live specimens about 1 mm long, anterior margin rounded and posterior pointing, translucent, pinkish-brownish colouration due to parenchymal glands (Figs
Castrella alba Luther, 1955 collected in Hamburg. A, B. Habitus of a swimming specimen; C. Details of the anterior part of the body; D–F. Posterior part of the body with atrial structures. e eye; ov ovary; ph pharynx; st stylet; vi vitellaria. Scale bars: 50 μm.
Castrella alba Luther, 1955 collected in Brandenburg. A. Habitus of a swimming specimen; B. Details of an egg and its stalk; C. Details of an egg and the stylet; D–F. Posterior part of the body with atrial structures. e eye; eg egg; egs egg stalk; ph pharynx; st stylet; vi vitellaria. Scale bars: 50 μm.
As noted by
This species has been broadly recorded in the United States, Iceland, Faroe Islands, overall Europe (United Kingdom, Ireland, Finland, Belgium, Germany, Austria, Switzerland, Czech Republic, Poland, Romania, Bulgaria, Latvia, Italy, France, and Spain), Russia, and Japan. See a summary of this distribution and main references in
One specimen studied alive and whole mounted (ZMH 13833), collected in Wandse river, submerged vegetation with organic matter, 0.1 m deep.
Live animal about 1 mm long, anterior margin rounded and posterior pointing, translucent, orange colouration due to parenchymal glands (Fig.
Microdalyellia armigera. A. Habitus of a swimming specimen; B. Seminal and prostate vesicles; C–F. Male stylet. e eye; eg egg; i intestine lumen; ph pharynx; pv prostate vesicle; st stylet; sv seminal vesicle; vi vitellaria. Scale bars: 100 μm (A); 50 μm (B–F).
Microdalyellia armigera shows a high morphological variability of the male sclerotised stylet, the main character to differentiate species in most microturbellarians. However, it would not be surprising if this variability represents cryptic speciation, as suggested by our phylogenetic analysis (see section Molecular Phylogenetic Analyses; Fig.
Species with a known distribution in West Europe (United Kingdom, Finland, Germany, and Switzerland) (
Observations on eight live animals, five whole mounted afterwards (ZMH 13834–13838) and the other three preserved in absolute ethanol (two already sequenced for molecular analyses); collected in Wittenberg, Rissen, on tree holes filled with water and litter, 20–50 cm over the ground level.
Animals 704–1010 µm long (x̄ = 840 µm; n = 3), with a pair of eyes (Fig.
Microdalyellia schmidtii. A. Habitus of a swimming specimen; B, C. Male atrial organs; D. Ovary; E, F. Male stylet. Scale bars: 100 μm (A); 50 μm (B–F).
The atrial organs are located in the posterior body third. The pair of testes (Fig.
Around 44 species of Microdalyellia have been recorded globally (
The Hamburg population of M. schmidtii is notable for its significantly larger stylet (140 µm) compared to other recorded populations: 92 µm in the United Kingdom (
Microdalyellia kupelwieseri. A–F. Male stylet; D. Detail of the bridge’s spine; E–F. Detail of the spiny branches. Scale bars: 50 μm (A–F).
Until now, the relationships among M. armigera, M. kupelwieseri, and M. schmidtii, and the validity of the latter two species, remained unclear. However, it is suggested that the group M. kupelwieseri – schmidtii can be distinguished from M. armigera by the reduced spine number in one arm, as well as the larger size of the single spines in M. schmidtii and the main spines of M. kupelwieseri compared to those in M. armigera. In this sense, our phylogenetic analysis contributed to clarify that the three species represent distinct lineages and support their validity. However, M. armigera could represent a complex of cryptic species (see section Molecular Phylogenetic Analyses; Fig.
Krumbachia Reisinger, 1924
Until now, this species was only known from its type locality in Schlitz, Hessen, Germany (
Sixteen specimens studied alive, five of them whole mounted (ZMH V13843–13847), nine preserved for future histological, and two used for molecular studies. Animals collected in Wittenberg, Rissen, on tree holes filled with water and litter, 20–50 cm over the ground level.
Live animals 1.5–2 mm long, unpigmented and without eyes (Fig.
Krumbachia hiemalis. A. Habitus of live specimens; B. Anterior region; C. Posterior region; D, E. Atrial organs. Scale bars: 50 μm (B–E).
The testes (Fig.
The vitellaria (Fig.
The morphology of the specimens collected in Hamburg closely aligns with the description outlined by
Continenticola Carranza, Littlewood, Clough, Ruiz-Trillo, Baguna & Riutort, 1998
Planarioidea Stimpson, 1857
Planariidae Stimpson, 1857
Planaria Müller, 1776
Species broadly distributed in West Europe (United Kingdom, Ireland, Belgium, Finland, Sweden, Denmark, Germany, Greece, France, and Italy) (
Six specimens studied alive and preserved in absolute ethanol for future molecular analyses; one collected in Wandse river, submerged vegetation with organic matter, 0.1 m deep; one in Planten un Blomen park, submerged litter, 0.3 m deep; and four in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep.
Live adult specimens measuring 0.5–1.5 cm, dark pigmented, with a pair of anterior eyes (Fig.
Planaria torva is a species widely distributed throughout West Europe, and it is frequently mentioned in taxonomic literature on triclads in the region. However, accurate identification of this species can be challenging without a detailed examination of internal morphology. The taxonomic history of P. torva has been contentious, with several studies mistakenly associating it with species of Dugesia (
Species recorded from The Netherlands (
Six specimens studied alive, preserved in absolute ethanol for future molecular analyses; collected in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep.
Mature specimens measuring 0.5–1.2 mm, dark coloured (Fig.
Polycelis tenuis. A. Habitus of swimming adult specimen; B. Squeezed adult specimen; C, D. Squeezed juvenile; E. Atrial organs; F. Spines of the penial papilla. Scale bars: 200 μm (D); 600 μm (E); 100 μm (F).
Three species of Polycelis have been documented in Germany, and they are widespread across Europe: P. felina, P. nigra, and P. tenuis (
Catenulida
The dataset of Catenulida included sequences of 56 specimens, representing at least 14 species of Stenostomum and two outgroups. Eight of these specimens were sequenced for the present study. After removing ambiguously aligned positions, the 18S, 28S rDNA, and COI mDNA alignments were 1612, 1473 and 553 bp long, respectively, resulting in a concatenated alignment of 3615 bp. Bayesian and ML topologies were congruent after collapsing of weakly supported clades. The resulting phylogeny of the analysis is shown in Fig.
Majority-rule consensus tree from the Bayesian analysis of the concatenated 18S + 28S rDNA + COI mDNA dataset of Stenostomum, Catenulida. Branches with support values below the thresholds in the legend of the three analyses were collapsed. Support values are represented in the order of posterior probabilities / SH-aLRT / ultrafast bootstrap. Branches without symbols have pp = 1, SH-aLRT = 100, and UFboot = 100. Taxa from which new sequences were obtained for this study are highlighted in bold.
All species of Stenostomum cluster in a highly supported clade (pp = 1; SH-aLRT = 98.8; UFboot = 98). Stenostomum arevaloi resulted as the sister to all other species of the genus included in the analysis (pp = 0.99; SH-aLRT = 47.5; UFboot = 63). Species within this large clade cluster into two groups, one containing Stenostomum handoelense, S. saliens, S. tuberculosum, S. heenuktense, and S. steveoi (pp = 1; SH-aLRT = 95.4; UFboot = 90); and the other (pp = 1; SH-aLRT = 79.6; UFboot = 82) including three subgroups: S. grabbskogense + S. bryophilum (pp = 1; SH-aLRT = 99.9; UFboot = 100), S. leucops + S. grande + S. leucops aquariorum (pp = 1; SH-aLRT = 96.4; UFboot = 96), and S. simplex + S. sphagnetorum + S. gotlandense (pp = 1; SH-aLRT = 100; UFboot = 100). The specimens of S. tuberculosum form two distinct clades within a polytomy with S. saliens (pp = 1; SH-aLRT = 67.3; UFboot = 79). Specimens of S. leucops form four lineages: one including specimens from Germany and Sweden (pp = 0.84; SH-aLRT = 100; UFboot = 99), and the others corresponding to single specimens from Finland (S. leucops and S. leucops aquariorum) and Brazil. One specimen of S. grande from Japan and three specimens of an unidentified species from Germany cluster together (pp = 0.91; SH-aLRT = 100; UFboot = 96) and this clade is sister to that including the specimens of S. leucops from Sweden and Germany (pp = 0.84; SH-aLRT = 80.7; UFboot = 85).
Stenostomum simplex forms two clades, one including specimens from Japan (Japan 3 and 4 in Fig.
Rhabdocoela
The dataset of Rhabdocoela included sequences of 97 specimens, representing 84 species. Ten of these specimens were sequenced for the present study. After removing ambiguously aligned positions, the 18S and 28S rDNA alignments were 1793 and 1743 bp long, respectively (concatenated alignment of 3536 bp). Bayesian and ML topologies were congruent after collapsing of weakly supported clades. The resulting phylogeny of the analysis is shown in Fig.
Majority-rule consensus tree from the Bayesian analysis of the concatenated 18S + 28S rDNA dataset of Rhabdocoela. Branches with support values below the thresholds in the legend of the three analyses were collapsed. Support values are represented in the order of posterior probabilities / SH-aLRT / ultrafast bootstrap. Branches without symbols have pp = 1, SH-aLRT = 100, and UFboot = 100. Taxa from which new sequences were obtained for this study are highlighted in bold.
As previously shown by Van Steenkiste et al. (2013), both ‘Typhloplanidae’ (pp = 1; SH-aLRT = 99.5; UFboot = 100) and Dalyelliidae (pp = 1; SH-aLRT = 100; UFboot = 100) form two highly supported clades (Fig.
Species of Castrella cluster in a fully supported clade (pp = 1; SH-aLRT = 100; UFboot = 100) which is the sister taxon to all other dalyelliids (pp = 1; SH-aLRT = 100; UFboot = 100). Three specimens of C. alba cluster together (pp = 1; SH-aLRT = 89.3; UFboot = 100) and form an unresolved group with C. truncata from Switzerland and C. pinguis + C. truncata from Canada (pp = 94; SH-aLRT = 87.7; UFboot = 98). Therefore, this analysis revealed the existence of cryptic diversity within C. truncata, containing, at least, an European and a North American lineages.
The second clade within Dalyelliidae forms a polytomy including the groups of most species of Gieysztoria (pp = 1; SH-aLRT = 100; UFboot = 100), species of Dalyellia + Pseudodalyellia alabamensis (pp = 1; SH-aLRT = 92.6; UFboot = 98), Dalyellidae n. gen. n. sp. + Gieysztoria cf. billabongensis (pp = 1; SH-aLRT = 100; UFboot = 100), and species of Microdalyellia (pp = 1; SH-aLRT = 100; UFboot = 100). The interrelationships of two analysed specimens of M. armigera are not fully resolved. Otherwise, specimens of M. kupelwieseri and M. schmidtii cluster together (pp = 1; SH-aLRT = 98.8; UFboot = 99). One specimen of M. schmidtii, collected in Belgium, clusters with two specimens of the same species collected in Hamburg (pp = 0.97; SH-aLRT = 79.7; UFboot = 99) and together are sister to a clade containing two specimens of M. kupelwieseri collected in Basel, Switzerland (pp = 1; SH-aLRT = 96.6; UFboot = 100).
There is no doubt that Germany boasts one of the most thoroughly researched and understood diversities of turbellarians worldwide. However, the distributional knowledge of this diversity varies significantly among different regions within Germany. Consequently, it is not uncommon to encounter new species records in areas with relatively limited sampling efforts. Undoubtedly, the sparse studies conducted in Hamburg and the limited number of species recorded highlight this region as poorly explored in terms of turbellarian diversity within Germany. It is necessary to emphasize the rich diversity of freshwater turbellarians found in urban and suburban environments of Hamburg, evidencing their importance for conservation. Particularly, the shallow irrigation ditch sampled in Kirchwerder-Fünfhausen hosted the highest found richness with eight species. Therefore, we suspect that a much higher diversity can be detected in a broader collecting campaign.
Our discoveries have led to the record of two already known catenulids for Germany, Stenostomun gotlandense and S. simplex. A third species, provisionally identified as Stenostomum sp., is related to Japanese specimens of S. grande (see Fig.
For instance, our study supports previous findings (i.e.
The cryptic diversity observed within the S. leucops – S. grande group appears to also apply to S. simplex. Specimens of S. simplex from Japan do not form a monophyletic clade, with two of them clustering alongside a specimen from Germany. As a result, our identification of the German specimen as S. simplex is provisional and requires further confirmation through more extensive morphological and phylogenetic analyses. The type localities of the three species discussed here—S. leucops, S. grande, and S. simplex—are all located in the United States. Therefore, studying specimens from their type localities is crucial to accurately delineate species boundaries. In contrast, S. tuberculosum shows a different pattern, with two distinct clusters emerging from our analysis. This divergence may be influenced, and potentially artificially generated, by the fact that two specimens are represented by partial 18S rDNA sequences (Japan 3 and 4), while the other two are represented by partial COI mDNA sequences (Japan 1 and 2).
Similarly, as occurs with species of Stenostomum, Prorhynchus stagnalis represents another case of cryptic diversity (
Our phylogenetic analysis suggests that Bothromesostoma should be synonymized with Mesostoma.
Hamburg specimens of Microdalyellia schmidtii stand out due to their stylet morphology, notably larger than that found in other populations of the species and its closely related counterpart M. kupelwieseri. Specimens of M. schmidtii were discovered alongside Krumbachia hiemalis in phytotelmata, which are tree holes containing water, a habitat that has received relatively little exploration in terms of meiofauna diversity (see
Our developed phylogenetic analysis illuminated the previously questioned validity of M. schmidtii and M. kupelwieseri, two species suggested as forms of M. armigera. Clearly, M. armigera forms distinct lineages with respect to the other two species, and, at the same time, seems to contain more than one species due to the different Finnish and Spanish lineages. Therefore, considering the broad distribution of M. armigera and the high morphological variability recorded for its populations (regarding the stylet size and spines number and size), it is indispensable to conduct a broad and integrative taxonomical study to clarify its diversity. On the other hand, the well-supported clades of M. schmidtii and M. kupelwieseri are morphologically diagnosable due to the spine present in the stylet’s bridge of M. kupelwieseri, a structure missing in M. schmidtii.
Freshwater triclads have been extensively studied across Europe but recent studies revealed several undescribed species, particularly of Dugesia, and a complex biogeographical and evolutionary history (Benítez-Álvarez et al. 2023;
In summary, our study sheds light on the complex and understudied diversity of turbellarians in Germany, particularly in Hamburg, where limited sampling has resulted in sparse species records. Our findings highlight the cryptic diversity within several genera, including Stenostomum, Mesostoma, and Microdalyellia, as well as the need for further research to clarify taxonomic boundaries, particularly in species with highly homogeneous morphologies. The morphological variability observed within Stenostomum leucops, S. grande, and S. simplex supports the existence of cryptic species, reinforcing the importance of comprehensive phylogenetic and morphological analyses, including studies of specimens from type localities. Additionally, our identification of Microdalyellia schmidtii and Krumbachia hiemalis in Hamburg’s unique phytotelmata habitats emphasizes the importance of exploring diverse aquatic environments to better understand the true extent of turbellarian diversity. Lastly, the need for accurate species identification through detailed morphological examination, as demonstrated in the case of Polycelis nigra and P. tenuis, remains critical for avoiding taxonomic misinterpretation and advancing the knowledge of freshwater turbellarian biodiversity in Germany and beyond.
Nancy F. Mercado-Salas and Marlies Monnens are thanked by their invaluable help with the phylogenetic analyses. We thank Lukas Schärer (Basel University, Switzerland) for helping with the identification of Macrostomum rostratum and the collecting in Basel. YLD is supported by a Georg Forster Research Fellowship (Alexander von Humboldt Foundation, Germany, grant number 3.2 - CUB - 1226121 - GF-P). We extend our gratitude to Tom Artois (Hasselt University, Belgium) for his valuable input on the identification of Microdalyellia schmidtii. Yusdiel Torres-Cambas provided assistance with specimen collection in Brandenburg.