Research Article
Print
Research Article
Little neighbours in Hamburg: free-living aquatic flatworms (Platyhelminthes)
expand article infoYander L. Diez§, Andreas Schmidt-Rhaesa
‡ Museum of Nature Hamburg – Zoology, Hamburg, Germany
§ Hasselt University, Diepenbeek, Belgium
Open Access

Abstract

Free-living flatworms, also known as turbellarians, are abundant and key components of aquatic habitats. They play vital roles in food webs and contribute to ecosystem health. However, our understanding of their diversity remains limited, even from comparably well-studied regions of Europe. In this work, we summarise the available records on aquatic turbellarians from Hamburg, Germany, provide new records based on material obtained during exploratory collecting, and place selected species in a molecular phylogenetic context. We sampled four localities in Hamburg, two urban and two suburban, and three other localities in Germany and Switzerland, collecting submerged vegetation, litter, and mosses. Prior to our investigation, Hamburg had documented 26 species of aquatic turbellarians. Our collections have led to the first recorded instances of Stenostomum gotlandense and Castrella alba in Germany, along with four new species for Hamburg: Macrostomum rostratum, Microdalyellia schmidtii, Krumbachia hiemalis, and Polycelis tenuis. Additionally, we provide updated information for five species previously recorded from Hamburg: S. leucops, Prorhynchus stagnalis, Microdalyellia armigera, Gyratrix hermaphroditus, and Planaria torva. The phylogenetic analysis revealed cryptic diversity within S. grande and S. leucops, with S. grande comprising two distinct clades (Brazil and Japan + Germany), and S. leucops consisting of four clades (Sweden + Germany, two from Finland, and Brazil). One of the Finnish clades, S. leucops aquariorum, is both morphologically and molecularly distinct, and we recognise it as a valid species, now S. aquariorum. Future research is needed to further clarify the relationships of the remaining clades of these two species, particularly with material from their type localities in the United States. Among rhabdocoel microturbellarians, we identified cryptic diversity within Castrella truncata (with European and North American lineages) and Microdalyellia armigera (encompassing Finnish and Spanish lineages). We also provided the first molecular evidence supporting the monophyly of Krumbachia following the sequencing of K. hiemalis. Conversely, species of Bothromesostoma were found to be nested within a clade containing species of Mesostoma, leading us to propose synonymising these genera. Overall, our study underscores the rich biodiversity potential of urban and suburban ecosystems for detecting freshwater turbellarian species, while highlighting the need for further research in Hamburg and across Germany to clarify species distributions. Moreover, molecular phylogenetic analyses have uncovered cryptic diversity in several species of catenulids and rhabdocoels, emphasizing the importance of future efforts to describe potential new species.

Key Words

Catenulida, cryptic diversity, Macrostomorpha, Prorhynchida, Proseriata, Rhabdocoela, Tricladida, turbellarian, urban biodiversity

Introduction

Free-living flatworms (Platyhelminthes) represent a fascinating yet understudied component of freshwater and terrestrial ecosystems worldwide. Their diverse morphologies, behaviours, and ecological roles render them invaluable subjects for understanding fundamental principles of biodiversity and ecosystem functioning (Schockaert et al. 2008; Kolasa and Tyler 2010; Dumont et al. 2014). Despite their ecological importance, the knowledge of free-living flatworm diversity remains fragmented and incomplete (see Diez et al. 2023). Historically overshadowed by their parasitic counterparts (Neodermata), free-living flatworms have often been overlooked in biodiversity surveys and taxonomic studies. However, recent advancements in molecular techniques, coupled with increased emphasis on freshwater and terrestrial ecosystem conservation, have sparked a renewed interest in elucidating the distribution, ecology, and evolutionary relationships of these enigmatic organisms (Benítez-Álvarez et al. 2023a; Brand 2023). Furthermore, there is also a much increased research effort in recent years, which can largely be attributed to the reported invasions of freshwater and land planarians (e.g. Benítez-Álvarez et al. 2023b; Justine et al. 2024).

In Germany, with its strong focus on biodiversity documentation and conservation efforts, the exploration of free-living flatworm diversity holds particular significance. The free-living flatworm fauna of Germany is, by far, the best studied worldwide since several classical taxonomists working on free-living flatworms were based in these regions. More than 400 species have been recorded from this country (Tyler et al. 2006–2024). Particularly, the marine fauna of Sylt, in the North Sea, is impressively well documented and includes more than 246 species (Armonies 2018, 2020, 2023). However, some regions of Germany have been poorly studied regarding free-living flatworm diversity, such as Hamburg. Very few studies documented and described specimens in this German region (Düren and Ax 1993; Müller and Faubel 1993) and others offered species lists (e.g. Volk 1903; Caspers 1953; Riemann 1965, 1966), recording 26 species. Most of these species are limnic but some of those from the Elbe river can be considered oligohaline due to the marine influence in the river. Hamburg is a relevant area for freshwater conservation due to its large number of protected areas (Behörde für Umwelt, Klima, Energie und Agrarwirtschaft – Abteilung Naturschutz Hamburg, 2024), which are impacted by human activities such as the development of the largest German harbour in the Elbe river. Hamburg offers a variety of freshwater habitats, including tidal flats, rivers, streams, lakes, ponds, harbour basins, irrigation ditches and others.

Germany’s diverse array of habitats, ranging from pristine mountain streams to urbanized landscapes (Potschin and Bastian 2004; Bruns and Stemmer 2018), provides a unique opportunity to investigate the ecological preferences and adaptive strategies of free-living flatworms across varied environmental gradients. Furthermore, the country’s long-standing tradition of citizen science initiatives and collaborative research networks (Richter et al. 2018; Liu et al. 2021) offers a robust framework for engaging both amateur enthusiasts and professional scientists in the documentation and monitoring of flatworm diversity.

In this paper, we aim to synthesize existing knowledge on the free-living, aquatic flatworms from Hamburg, Germany. We record for the first time two species new to Germany and four species new to Hamburg, and provide new information for five species previously recorded to Hamburg. Finally, we reconstructed the molecular phylogenetic relationships for selected species of Catenulida and Rhabdocoela.

Material and methods

Sampling

The current research started with the revision of the available literature documenting the free-living, aquatic flatworms from Hamburg (see Table 1). Later, we conducted exploratory samplings in both urban and suburban ecosystems of the city. Samplings were conducted in the suburban forest of Wittenberg, Rissen (53°33'53"N, 09°45'04"E) (April 2, 2023), exploring the habitats formed by the accumulation of water on tree’s holes. Secondly, submerged vegetation of Wandse river (53°34'28.8"N, 10°03'14.6"E) (September 6, 2023) and litter from the park Planten un Blomen (53°33'31.9"N, 09°59'04.6"E) (March 4, 2024), within Hamburg City were collected. Finally, a suburban farming area was sampled; samples were taken from a shallow irrigation ditch on a moist meadow in Kirchwerder-Fünfhausen (53°27'19.2"N, 10°08'28.9"E) (March 19, 2024).

Table 1.

Checklist of the freshwater turbellarians from Hamburg, Germany, including new records.

Group Species Localities Habitat References
Catenulida Rhynchoscolex simplex Leidy, 1852 Elbe river, Hamburg Harbor (Köhlbrand) medium sand with little detritus Riemann 1966
detritus-free medium sand Riemann 1966
Elbe river, Bank near Hamburg - Riemann 1966
Stenostomum ciliatum Kepner & Carter, 1931 Elbe river littoral Volk 1903
Stenostomum gotlandense Larssson & Willems, 2010 Kirchwerder-Fünfhausen submerged vegetation and litter This study
Stenostomum grabbskogense Luther, 1960 Elbe river, Krauel muddy substrates covered with algae Müller and Faubel 1993
Stenostomum leucops (Duges, 1828) Schmidt, 1848 Elbe river littoral Volk 1903
Kirchwerder-Fünfhausen submerged vegetation and litter This study
Macrostomorpha Microstomum lineare (Müller, 1773) Schmidt, 1848 Elbe river, Krauel muddy substrates covered with algae Müller and Faubel 1993
Elbe river littoral Volk 1903
Macrostomum rostratum Papi, 1959 Wandse river vegetation with organic matter, 0.1 m deep This study
Macrostomum hystrix Ørsted, 1843 Elbe river littoral Volk 1903
Tricladida Dendrocoelum lacteum (Müller, 1774) Ørsted, 1844 Außen- and Binnenalster - Caspers 1953
Elbe river littoral Volk 1903
Planaria torva (Müller, 1773) Müller, 1776 Außen- and Binnenalster littoral Volk 1903
Elbe river littoral Volk 1903
Wandse river vegetation with organic matter, 0.1 m deep This study
Planten un Blomen park rotten vegetation, 0.2 m deep This study
Polycelis nigra (Müller, 1774) Ehrenberg, 1831 Elbe river littoral Volk 1903
Polycelis tenuis Ijima, 1884 Kirchwerder-Fünfhausen submerged vegetation and litter This study
Proseriata Boreusyrtis neiswestnovae (Riemann, 1965) Lukhnev, Koroleva, Kirilchik & Timoshkin, 2017 Elbe river, near Hamburg-Harburg muddy substrate, 2–8 m deep Riemann 1965
Coelogynopora schulzii Meixner, 1938 Elbe river, near Hamburg-Harburg sandy beach, intertidal Düren and Ax 1993
Paramonotus hamatus (Jensen, 1878) Meixner, 1938 Elbe river, near Hamburg-Harburg sandy beach, intertidal Düren and Ax 1993
Hamburg Harbour intertidal, detritus-free medium sand Riemann 1965
subtidal, muddy substrate Riemann 1965
Pseudosyrtis subterranea (Ax, 1951) Ax, 1956 Elbe river, near Hamburg-Harburg sandy beach, intertidal Düren and Ax 1993
Prolecithophora Plagiostomum lemani Forel & Du Plessis, 1874 Elbe river littoral Volk 1903
Prorhynchida Prorhynchus stagnalis Schultze, 1851 Elbe river littoral Volk 1903
Kirchwerder-Fünfhausen submerged vegetation and litter This study
Rhabdocoela Baicalellia brevituba (Luther, 1918) Nasonov, 1930 Elbe river, Krauel muddy substrates covered with algae Müller and Faubel 1993
Castrella alba Luther, 1955 Kirchwerder-Fünfhausen submerged vegetation and litter This study
Microdalyellia armigera (Schmidt, 1862) Gieysztor, 1938 Elbe river littoral Volk 1903
Wandse river vegetation with organic matter, 0.1 m deep This study
Microdalyellia schmidtii (Graff, 1882) Gieysztor, 1938 Wittenberg, Rissen tree holes filled with water, 20–50 cm over the ground level This study
Phaenocora gracilis (Vejdovsky, 1895) Graff, 1909 Elbe river littoral Volk 1903
Phaenocora typhlops (Vejdovsky, 1880) Hofsten, 1907 Elbe river, Krauel muddy substrates covered with algae Müller and Faubel 1993
Phaenocora unipunctata (Ørsted, 1843) Bendl, 1908 Elbe river littoral Volk 1903
Olisthanella truncula (Schmidt, 1858) Voigt, 1892 Elbe river littoral Volk 1903
Mesostoma ehrenbergii (Focke, 1836) Örsted, 1843 Elbe river littoral Volk 1903
Mesostoma lingua (Abildgaard, 1789) Schmidt, 1848 Elbe river littoral Volk 1903
Mesostoma tetragonum (Müller, 1774) Schmidt, 1848 Elbe river littoral Volk 1903
Krumbachia hiemalis Schwank, 1979 Wittenberg, Rissen tree holes filled with water, 20–50 cm over the ground level This study
Gyratrix hermaphroditus Ehrenberg, 1830 Elbe river, near Hamburg-Harburg sandy beach, intertidal Ax 1957
Elbe river littoral Volk 1903
Wandse river vegetation with organic matter, 0.1 m deep This study
Kirchwerder-Fünfhausen submerged vegetation and litter This study
Placorhynchus dimorphis Karling, 1947 Elbe river Krauel muddy substrates covered with algae Müller and Faubel 1993

Additional samplings, in order to collect relevant material for molecular analyses, were conducted in Switzerland: Röserental, Basel (47°29'35.0"N, 07°41'37.8"E) (April 12, 2024), and other German localities: Groß Glienicker lake, Brandenburg (52°28'25.7"N, 13°06'57.6"E) (March 26, 2024); and near List, Sylt (55°02'03.1"N, 08°25'07.8"E) (June 24, 2024).

The flatworms were extracted by oxygen depletion (Schockaert 1996). Afterwards, they were studied alive and specimens with hard genital structures were whole mounted with lactophenol. Specimens of species without sclerotised structures and some of the ones with hard structures were preserved in absolute ethanol for molecular analyses. Drawings of the hard parts were made with a camera lucida on a Leica DM 2500 microscope, using Nomarski interference contrast. Measurements were taken along the central axis of the measured object. For the classification of the sclerotised atrial structures in species of Polycystididae, we followed Artois and Schockaert (2003). Voucher material is stored in the Museum of Nature – Zoology, Hamburg (ZMH), which is part of the Leibniz Institute for the Analysis of Biodiversity Change (LIB).

DNA extraction, amplification and sequencing

Total DNA of selected taxa was extracted using a protocol for low-input tissues (Laumer 2023). The specimens were processed with 195 µl of the TNES lysis buffer and 5 µl of proteinase K (Invitrogen) at 55 °C for 1 hour. Subsequently, 1.5 µl yeast tRNA (Invitrogen) as coprecipitant, 65 µl 5M NaCl, and 290 µl 96% EtOH were added to the lysed. Then the samples were stored at -20 °C for 2 hours. Later, the lysed was centrifuged (18 000 rpm) and the supernatant was discarded. Purification was performed with two 70% EtOH wash steps and, finally, the DNA was resuspended overnight at 4 °C in 0.1X TE buffer with 0.02% Tween™ 20 (Thermofisher).

For the selected specimens (Catenulida and Rhabdocoela), we amplified partial sequences of the 18S and 28S ribosomal DNA genes (rDNA). Additionally, for catenulids a fragment of the COI mitochondrial DNA gene (mDNA) was also amplified. Amplification primers and protocols varied according to the taxa (Catenulida or Rhabdocoela) (Table 2). The PCR products were verified on a 1% agarose gel, stained with HD Green Plus (Intas Science Imaging), and purified with ExoCleanUp FAST (Avantor). Sequencing was carried out by Macrogen Europe B.V. (Amsterdam) under BigDyeTM terminator cycling conditions on an ABI3730XL DNA Sequencer.

Table 2.

Primer sequences and protocols used for PCR amplification.

Primer Direction Primer sequence (5’-3’) Reference
Rhabdocoela subunit 18S
TimA Forward AMCTG GTT GAT CCT GCCAG Willems et al. (2006)
TimB Reverse TGATCCATCTGCAGGTTCACCT Willems et al. (2006)
95 °C * 5 min 10 s, 30X (94 °C * 30 s, 55 °C * 30 s, 72 °C * 90 s), 72 °C * 5 min
Rhabdocoela subunit 28S
LSU5 Forward TAG GTC GAC CCG CTG AAY TTA Van Steenkiste et al. (2013)
LSU6-3B Reverse GAG AAG GGT TCC ATG TGA ACAGC Van Steenkiste et al. (2013)
95 °C * 5 min 10 s, 30X (94 °C * 60 s, 50 °C * 60 s, 72 °C * 90 s), 72 °C * 5 min
Catenulida subunit 18S
U95947-0025 Forward CATATGCTTGTCTCAAAG Yamasaki et al. 2012
U95947-1788 Reverse GGAAACCTTGTTACGACT Yamasaki et al. 2012
94 °C * 3 min, 35X (94 °C * 1 min, 50 °C * 1 min, 72 °C * 2 min), 72 °C * 8 min
Catenulida subunit 28S
LSU5 Forward TAG GTC GAC CCG CTG AAY TTA Larsson and Jondelius 2008
L1642R Reverse CCAGCGCCATCCATTTTCA Larsson and Jondelius 2008
94 °C * 3 min, 38X (94 °C * 30 s, 50 °C * 30 s, 72 °C * 30 s), 72 °C * 5 min
Catenulida subunit COI
COI5B Forward TTCTGRTTYTTYGGNCAY CC Rosa et al. 2015
COI3B Reverse AAGTGTTGNGGRARAANGT Rosa et al. 2015
95 °C * 5 min, 30X (94 °C * 1 min, 50 °C * 1 min, 72 °C * 1 min), 72 °C * 3 min

Molecular phylogenetic analyses

Obtained contigs were quality-trimmed (error probability = 0.05) and assembled in Geneious Prime v2025.0 (Kearse et al. 2012). Consensus sequences were subjected to a BLAST search (Altschul et al. 1990) on the NCBI website (https://ncbi.nlm.nih.gov) to check for signs of contamination. To detect potential pseudogenes, newly obtained COI mDNA sequences were translated in Geneious (translation Table 5) and visually screened for the presence of stop codons. Available sequences relevant for our phylogenetic analyses were mined from GenBank (see Table 3 for Catenulida and Table 4 for Rhabdocoela) (Benson et al. 2012). Separate datasets were compiled for catenulids: 18S (43 sequences) and 28S rDNA (35 sequences), and COI mDNA (47 sequences), and rhabdocoels: 18S (98 sequences) and 28S rDNA (72 sequences). Following the results of Larsson et al. (2008), Catenula turgida (Zacharias, 1902) Larsson, Ahmadzadeh & Jondelius, 2008 and Rhynchoscolex simplex Leidy, 1852 were included as outgroup for the analyses of Stenostomum. Based on previous studies (Van Steenkiste et al. 2021; Diez et al. 2023), we selected two species of Temnocephalidae: Halammovortex sp. and Temnosewellia fasciata (Haswell, 1887) Damborenea & Cannon, 2001, and two of Jenseniidae: T. minor (Haswell, 1887) Damborenea & Cannon, 2001 and Grappleria corona Van Steenkiste, Rivlin, Kahn, Wakeman & Leander, 2021, as outgroups for the analysis of the rhabdocoel families ‘Typhloplanidae’ and Dalyelliidae.

Table 3.

GenBank accession numbers of Catenulida used in the study (*new sequences).

Species 18S rDNA 28S rDNA COI Distribution
Stenostomum arevaloi K04_53 FJ384808 FJ384847 FJ384889 Sweden
S. arevaloi K04_80 FJ384810 FJ384849 FJ384895 Sweden
S. arevaloi K05_60 FJ384833 FJ384871 FJ384910 Sweden
S. bryophilum K04_09 FJ384799 FJ384836 FJ384875 Sweden
S. bryophilum K04_30 FJ196320 FJ384843 FJ384882 Sweden
S. bryophilum K04_49 FJ384845 FJ384888 Sweden
S. bryophilum K04_71 FJ196333 FJ196343 FJ384892 Sweden
S. bryophilum K04_78 FJ196334 FJ384894 Sweden
S. gotlandense K04_81 FJ384811 FJ384850 FJ384896 Sweden
S. gotlandense K04_90 FJ384855 FJ384900 Sweden
S. gotlandense K04_93 FJ384856 FJ384901 Sweden
S. gotlandense K04_94 FJ384902 Sweden
S. gotlandense D-259 *PQ722290 *PQ722307 *PQ687017 Hamburg, Germany
S. grabbskogense K04_06 FJ196326 FJ196337 FJ384874 Sweden
S. grabbskogense K04_11 FJ196327 FJ196338 FJ384876 Sweden
S. grabbskogense K04_12 FJ384838 FJ384877 Sweden
S. grabbskogense K04_15 FJ384839 FJ384878 Sweden
S. grabbskogense K04_19 FJ384801 FJ384841 FJ384880 Sweden
S. grabbskogense K05_27 FJ384827 FJ384867 FJ384907 Sweden
S. grande KM056359 Brazil
S. grande AB665104 AB665116 Japan
Stenostomum sp. G-11 *PQ722293 *PQ722310 Brandenburg, Germany
Stenostomum sp. G-12 *PQ722294 *PQ722311 Brandenburg, Germany
Stenostomum sp. S-260 *PQ722296 *PQ722313 Sylt, Germany
S. handoelense K05_17 FJ384823 FJ384864 FJ384905 Sweden
S. handoelense K05_20 FJ384824 FJ384865 FJ384906 Sweden
S. heebuktense K04_45A FJ196330 FJ384887 Sweden
S. leucops KJ476143 Brazil
S. leucops AJ405976 AJ405976 Finland
S. leucops D-229 *PQ722295 *PQ722312 Sylt, Germany
S. leucops D-257 *PQ722291 *PQ722308 Hamburg, Germany
S. leucops D-258 *PQ722292 *PQ722309 Hamburg, Germany
S. leucops K04_18 FJ384800 FJ384840 FJ384879 Sweden
S. leucops K04_29 FJ384804 FJ384842 FJ384881 Sweden
S. leucops K04_63A FJ384891 Sweden
S. leucops K04_75 FJ384809 FJ384848 FJ384893 Sweden
S. leucops K04_85 FJ384812 FJ384852 FJ384898 Sweden
S. leucops K04_87 FJ384813 FJ384853 FJ384899 Sweden
S. leucops K05_51 FJ384830 FJ384869 FJ384908 Sweden
S. leucops K05_55 FJ384832 FJ384870 FJ384909 Sweden
S. leucops aquariorum AJ012519 AJ012519 Finland
S. saliens 1 AB665114 AB665123 Japan
S. saliens 2 AB665115 AB665124 Japan
S. simplex 1 AB665105 AB665117 Japan
S. simplex 2 AB665107 AB665118 Japan
S. simplex 3 AB665109 AB665119 Japan
S. simplex 4 AB665110 AB665120 Japan
S. simplex S-227 *PQ687018 Sylt, Germany
S. sphagnetorum K04_01 FJ384797 FJ384873 Sweden
S. sphagnetorum K05_07 FJ384818 FJ384860 FJ384904 Sweden
S. steveoi K04_59 FJ196331 FJ384890 Sweden
S. steveoi K04_84 FJ384851 FJ384897 Sweden
S. tuberculosum 1 AB665121 Japan
S. tuberculosum 2 AB665122 Japan
S. tuberculosum 3 AB665112 Japan
S. tuberculosum 4 AB665113 Japan
Catenula turgida K04_32 FJ384805 FJ196339 FJ384883 Sweden
Rhynchoscolex simplex K04_41 FJ384806 FJ384844 FJ384885 Sweden
Table 4.

GenBank accession numbers of Rhabdocoela used in the study (*new sequences).

Species 18S rDNA 28S rDNA
Acrochordonoposthia conica KC529487 KC529617
Bothromesostoma personatum KC529501
Bothromesostoma personatum M58347
Bothromesostoma sp. D85098
Bryoplana xerophila KC529489 KC529619
Carcharodopharynx sp. KC529481 KC529612
Castrada hofmanni KC529496
Castrada intermedia KC529497
Castrada lanceola AY775751
Castrada luteola AY775752
Castrada neocomensis KC529498
Castrada viridis AY775753
Castrella alba D-282 *PQ722297 *PQ722314
Castrella alba D-283 *PQ722298 *PQ722315
Castrella alba G-29 *PQ722299 PQ722316
Castrella pinguis KC529438 KC529569
Castrella truncata AY775777 KC529570
Castrella truncata Switzerland B-21 *PQ722300 *PQ722317
Dalyellia tatrica KC529443 KC529574
Dalyellia viridis KC529444 KC529575
Dalyelliidae n. gen. n. sp. KC529441
Dochmiotrema limicola KC529495 KC529624
Dochmiotrema sp. PP723168 PP723167
Gieysztoria acariaia KC529470 KC529601
Gieysztoria ashokae KC529466 KC529597
Gieysztoria beltrani KC529475 KC529606
Gieysztoria cf. billabongensis KC529442 KC529573
Gieysztoria cf. cuspidata KC529457 KC529588
Gieysztoria choctaw KC529476 KC529607
Gieysztoria complicata KC529473 KC529604
Gieysztoria cuspidata KC529458 KC529589
Gieysztoria dodgei KC529479 KC529610
Gieysztoria garudae KC529467 KC529598
Gieysztoria iberica KC529461 KC529592
Gieysztoria infundibuliformis KC529468 KC529599
Gieysztoria knipovici KC529463
Gieysztoria ornata KC529460 KC529591
Gieysztoria pavimentata KC529472 KC529603
Gieysztoria rubra KC529480 KC529611
Gieysztoria sp. n. 1 scissors KC529454 KC529585
Gieysztoria sp. n. 2 spine KC529455 KC529586
Gieysztoria sp. n. 3 aberrant KC529456 KC529587
Gieysztoria sp. n. 4 indian KC529464 KC529595
Gieysztoria sp. n. 5 red KC529469 KC529600
Gieysztoria sp. n. 6 ‘brown’ KC529474 KC529605
Gieysztoria sp. n. 7 hooklet KC529477 KC529608
Gieysztoria sp. n. 8 sardinia KC529462 KC529593
Gieysztoria sp. par YG 2018 MG820105.2 MG820107.2
Gieysztoria sp. pel YG 2018 MG820112 MG820115
Gieysztoria sp. ZCX 2012_1 JQ999991
Gieysztoria sp. ZCX 2012_2 JQ999992
Gieysztoria sp. ZXY 2011 HQ993097
Gieysztoria triquetra KC529478 KC529609
Gieysztoria zuluensis KC529465 KC529596
Krumbachia sp. KC529488 KC529618
Krumbachia hiemalis D-159 *PQ722301 *PQ722322
Krumbachia hiemalis D-160 *PQ722302 *PQ722323
Mesocastrada sp. U70081
Mesostoma lingua AY775759 KC529626
Mesostoma lingua AY775759 AY775759
Mesostoma lingua KC529626 KC529626
Mesostoma lingua AJ243682 AJ243682
Mesostoma thamagae AY775760
Microdalyellia armigera Finland KC529451 KC529582
Microdalyellia armigera Spain KC529452 KC529583
Microdalyellia brevispina KC529450 KC529581
Microdalyellia fairchildi KC529447 KC529578
Microdalyellia fusca KC529453 KC529584
Microdalyellia kupelwieseri Switzerland B-11 *PQ722303 *PQ722320
Microdalyellia kupelwieseri Switzerland B-12 *PQ722304 *PQ722321
Microdalyellia nanella KC529449 KC529580
Microdalyellia picta KC529446 KC529577
Microdalyellia rossi KC529448 KC529579
Microdalyellia schmidtii Belgium KC529445 KC529576
Microdalyellia schmidtii Hamburg D-156 *PQ722305 *PQ722318
Microdalyellia schmidtii Hamburg D-158 *PQ722306 *PQ722319
Microdalyellia sinensis JF429837
Microdalyellia sp. ZXY 2011 HQ993095
Olisthanella truncula KC529494 KC529623
Olisthanella truncula AY775761 AY775761
Opistomum arsenii KC529491 KC529620
Phaenocora foliacea KC529492 KC529621
Phaenocora shenda PHE1-18 ON843455 ON843453
Phaenocora shenda PHE2-18 ON843456 ON843454
Phaenocora sp. n. KC529493 KC529622
Phaenocora unipunctata AY775762
Protoplanella simplex KC529490
Pseudodalyellia alabamensis KC529440 KC529571
Rhynchomesostoma rostratum KC529499 KC529625
Rhynchomesostoma rostratum UH77.15 KC529500
Strongylostoma devleeschouweri KC529486
Strongylostoma elongatum AY775771
Strongylostoma elongatum spinosum KC869830 KC869883
Strongylostoma radiatum KC529485 KC529616
Typhloplana viridata KC529484 KC529615
Grappleria corona MW052803 MW052802
Halammovortex sp. KC529437 KC529567
Temnocephala fasciata KC869834 KC869888
Temnosewellia minor AY157183 AY157164
Table 5.

Best-fitting partitions and substitution models used in the phylogenetic analyses, as calculated in ModelFinder (Kalyaanamoorthy et al. 2017) according to AICc.

Dataset Partition scheme Substitution model MrBayes friendly model
Rhabdocoela 18S, 28S rDNA GTR+F+I+G4 GTR+F+I+G4
Catenulida 18S rDNA TIMe+G4 SYM+G4
28S rDNA TIM+F+G4 GTR+F+G4
1st and 2nd codon positions of COI GTR+F+I+G4 GTR+F+I+G4
3rd codon positions of COI TIM+F+G4 GTR+F+I+G4

Ribosomal datasets were aligned using MAFFT v7, as implemented in Geneious (Katoh and Standley 2013; Katoh et al. 2017). COI dataset was translationally aligned using the MUSCLE v3.8.425 (Edgar 2004) executable implemented in Geneious. The resulting alignments were concatenated in Geneious. An initial partitioning scheme defining gene boundaries was manually constructed. Separate partitions were specified for the three codon positions in the COI alignment. The concatenated alignment and partition files were used as input for the ModelFinder tool (Kalyaanamoorthy et al. 2017) on the IQ-TREE webserver (Trifinopoulos et al. 2016). Model fit was evaluated using the Akaike Selection Criterion and partition merging was enabled (Lanfear et al. 2012). The latter feature determines the best-fit partitioning scheme for a particular dataset, while also calculating the best-fitting evolutionary models for each selected subset.

Maximum likelihood (ML) analyses were conducted using the ‘Tree Inference’ tool on the IQ-TREE server (Nguyen et al. 2015), using edge-linked partitions. Branch support was assessed by ultrafast bootstrapping (UFboot) (Hoang et al. 2017) and the nonparametric approximate likelihood-ratio test (SH-aLRT) (Guindon et al. 2010), both with 1000 replicates. Bayesian inference (BI) was carried out using the Metropolis-coupled Markov Chain Monte Carlo (MC3) algorithm, implemented in MrBayes v3.2.6 (Ronquist et al. 2012) on the CIPRES Science Gateway (Miller et al. 2010). Best-fitting partitions and substitution models were specified where possible; otherwise, the second most complex model implemented in MrBayes was chosen. Two independent runs were conducted simultaneously for 10,000,000 generations, each including one cold and three heated chains. Trees were sampled every 1000th generation, the first 25% being discarded as burn-in. Chain convergence was confirmed by the average standard deviation of split frequencies dropping below 0.01, the potential scale reduction factor approaching 1.0, and the log probability reaching a stationary distribution. Obtained topologies were summarised in a majority-rule consensus tree. Inferred posterior probabilities (pp) were employed as support values. ML and BI trees were visualised and rooted in FigTree v1.4.4 (Rambaut 2006–2019). Weakly supported clades (pp < 0.95, SH-aLRT < 80, and UFboot < 95) were collapsed.

Results

Aquatic turbellarians from Hamburg

The literature review revealed the presence of 26 species of aquatic turbellarians previously documented in Hamburg (Table 1). Among these, the most diverse taxon is Rhabdocoela, comprising 11 species. Additionally, between one and four species have been documented in the following taxa: Catenulida, Macrostomorpha, Tricladida, Proseriata, Prorhynchida, and Prolecithophora. The species records span the time between 1903 and 1993. The majority of these findings originate from the Elbe river, with only a few specimens collected in smaller rivers and tributaries of the Elbe. The localities sampled during our survey differ from those previously studied.

Based on our collected material, the catenulid Stenostomum gotlandense Larsson & Willems, 2010 and the rhabdocoel Castrella alba Luther, 1955 are recorded for the first time from Germany. Four species are recorded for the first time from Hamburg: Macrostomum rostratum Papi, 1959, Microdalyellia schmidtii (Graff, 1882) Gieysztor, 1938, Krumbachia hiemalis Schwank, 1979, and Polycelis tenuis Ijima, 1884. Five known species, previously recorded to Hamburg were also collected during our field work: Stenostomum leucops (Duges, 1828) Schmidt, 1848, Prorhynchus stagnalis Schultze, 1851, Gyratrix hermaphroditus Ehrenberg, 1831, Microdalyellia armigera (Schmidt, 1862) Gieysztor, 1938, and Planaria torva (Müller, 1773). Considering our findings, the current number of aquatic turbellarians known from Hamburg is 31 species.

Taxonomy

Platyhelminthes Minot, 1876

Catenulida Meixner, 1924

Stenostomidae Vejdovsky, 1880

Stenostomum Schmidt, 1848

Stenostomum gotlandense Larsson & Willems, 2010

Fig. 1

Known distribution

Species only known, until now, from Gotland, Sweden (Larsson et al. 2008; Larsson and Willems 2010).

Material

Two specimens studied alive and stored in absolute ethanol for molecular analyses, one of them sequenced; collected in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep.

Remarks

Specimens measuring 768–957 µm long ( = 863 µm; n = 2) and 90–110 µm at widest point ( = 100 µm; n = 2), with two zooids, slender, tapering to both rounded extremes (Fig. 1A). The ciliated pits (Fig. 1B: cp) are relative short and open close to the most anterior part of the body. The epidermis is fully ciliated. Larger cilia are distributed along the body, particularly in the anterior and posterior ends. The brain (Fig. 1B: br) consists of two pairs of lobes, the anterior brain (Fig. 1C: ab) and the posterior brain (Fig. 1C: pb). We were not able to determine the exact number of compartments of the anterior brain, but in one specimen there appear to exist seven. Refractile bodies not present. Proximal rim of the pharynx (Fig. 1A, B: ph) with a number of folds and surrounds the large mouth opening (Fig. 1A, B: m). The protonephridium (Fig. 1D: pn) ends in a nephridiopore at the posterior end of the body.

Figure 1.

Stenostomum gotlandense. A. Habitus of a swimming specimen; B. Anterior part of the body; C. Anterior part of the body showing the brain; D. Posterior part of the body. Abbreviations: ab anterior brain; br brain; cp ciliated pits; ep excretophore; i intestine; m mouth; pb posterior brain; ph pharynx; pn protonephridia. Scale bars: 50 μm (A, C); 100 μm (B, D).

As noted by Larsson and Willems (2010), the folded rim of the pharynx, the large mouth opening, and the small ciliated pits represent a unique combination of morphological traits within Stenostomum. Our morphological identification is further corroborated by the phylogenetic analysis, leading us to confidently report this species for the first time in Germany, specifically in Hamburg. The German specimens are similar in size, considering the length of the first zooid (495–588 µm), to those from Sweden (500 µm). However, Larsson and Willems (2010) observed that their specimens exhibited approximately 10 compartments in the anterior brain, whereas the specimens from Hamburg present about seven. Nonetheless, one specimen illustrated by Larsson and Willems (2010: fig. 3B) shows only six segments in the anterior brain.

Stenostomum leucops (Duges, 1828) Schmidt, 1848

Fig. 2

Known distribution

Species with a broad distribution through North America (United States and Mexico) (Higley 1918; Nuttycombe and Waters 1938; Kolasa et al. 1987; Núñez-Ortiz et al. 2016; Glasgow 2021), South America (Argentina, Brazil, Peru, and Suriname) (Marcus 1945; van der Land 1970; Noreña-Janssen 1995; Gamo and Leal-Zanchet 2004; Noreña et al. 2005; Damborenea et al. 2011; Reyes et al. 2021), Iceland and Faroe Islands (Steinböck 1948), West Europe (United Kingdom, Ireland, The Netherlands, Germany, Switzerland, and Spain) (Graff 1882; Hofsten 1911; Gieysztor 1931; Young 1970, 1972, 1973; Noreña et al. 2007), East Europe (Poland, Romania, Serbia, and Croatia) (Graff 1882; Steinböck 1933; Kolasa 1971; Mack-Fira 1974), Russia (Nasonov 1926; Steinböck 1932; Timoshkin et al. 2010), Asia (Thailand and Japan) (Yamazaki et al. 2012; Ngamniyom and Panyarachun 2016), and Africa (Tanzania and Kenya) (Young and Kolasa 1974; Young 1976).

Material

Three specimens studied alive and stored in absolute ethanol; collected in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep. Three specimens studied alive and stored in absolute ethanol; collected in Groß Glienicker lake, littoral, floating vegetation. Three specimens studied alive and stored in absolute ethanol; collected in Sylt, floating vegetation in a small pond. Two specimens from Kirchwerder-Fünfhausen and one from Sylt were sequenced for the molecular analyses.

Remarks

Specimens measuring 1120–1490 µm long ( = 1305 µm; n = 2) and 175–220 µm at widest point ( = 198 µm; n = 2), with two zooids, anterior end rounded and posterior tapering (Fig. 2A–C). The ciliated pits (Fig. 2D: cp) are relative short and open close to the most anterior part of the body. The epidermis is fully ciliated. Larger cilia are distributed along the body, particularly in the anterior and posterior ends. The brain (Fig. 2A, B, D: br) consists of two pairs of lobes, the anterior brain (Fig. 2F, G: ab) and the posterior brain (Fig. 2F, G: pb). The anterior brain is more distinct but does not show a clearly compartments. A pair of refractile bodies (Fig. 2F, G: rb) are connected to the posterior brain via stalked structures. The refractile bodies are 8–9 µm in diameter (n = 3). The number of spherules contained in the refractile bodies is difficult to observe but they are more than 20 in all studied specimens. The refractile bodies can appear either rounded or crescent-shaped, depending on the orientation of these structures.

Figure 2.

Stenostomum leucops. A–C Habitus of swimming specimens; D. Anterior part of the body; E. Posterior part of the body F, G. Anterior part of the body. Abbreviations: ab anterior brain; br brain; cp ciliated pits; i intestine; m mouth; np nephridiopore; pb posterior brain; ph pharynx; phg pharyngeal glands. Scale bars: 200 μm (A–C); 100 μm (D, E); 50 μm (F, G).

Our identification of specimens was primarily based on Luther’s (1960) description. However, recent studies have suggested that S. leucops may actually represent a complex of cryptic species, possibly related to S. grande Child, 1902 (see Yamazaki et al. 2012; Rosa et al. 2015). Molecular evidence supports this notion and echoes earlier discussions by Nuttycombe and Waters (1938) and Marcus (1945), who both deemed the available description insufficient for clear recognition of the species. Rosa et al. (2015) identified three distinct clades within S. leucops, each distributed in Brazil, the United Kingdom, and Sweden, respectively, but were unable to find morphological diagnostic traits to differentiate them. The phylogenetic analysis here developed (see section Molecular phylogenetic analyses) shows a close relationship between S. leucops from Germany and Sweden.

Given that the type locality of S. leucops is in the vicinity of New York, United States, a comprehensive morphological and molecular phylogenetic analysis of specimens from that area is essential to stabilize the classification of S. leucops (see Discussion).

Rhabditophora Ehlers, 1985

Macrostomorpha Doe, 1986

Macrostomidae Beneden, 1870

Macrostomum Schmidt, 1848

Macrostomum rostratum Papi, 1951

Fig. 3

Known distribution

Species with a broad known distribution including Europe (United Kingdom, The Netherlands, Germany, Finland, Spain, and Italy) (Papi 1951; Luther 1960; Rixen 1961; Young 1970, 1973; Tulp 1974; Farias et al. 1996; Noreña et al. 2007), Russia (Luther 1960), and Kenya (Young 1976).

Material

Two specimens studied alive, one preserved in ethanol for future molecular analyses, the second cut in two pieces, the posterior part containing the stylet for whole mounting and the anterior part preserved for molecular analyses. Collected in Wandse river, submerged vegetation with organic matter, 0.1 m deep.

Description. Animals 0.8–0.9 mm long (n = 2), unpigmented and with a pair of eyes (Fig. 3A, B: e). General morphology corresponds to that in previously described specimens (see Papi 1951). Epidermis fully ciliated, with some larger cilia distributed though the body. False seminal vesicle absent and true seminal vesicle (Fig. 3C–E: sv) opening into the prostate vesicle (vesicula granulorum). The prostate vesicle (Fig. 3C–F: pv) opens proximally into the stylet (Fig. 1A, C–F: st). One specimen had a fully developed stylet, measuring 60 µm in length; it is hook shaped and with the distal part twisted; aperture subdistal and dorsal. Well-developed eggs observed (Fig. 3A, C: eg).

Figure 3.

Macrostomum rostratum. A. Habitus of a swimming specimen; B. Anterior part of the body; C–F. Posterior part of the body. Abbreviations: e eye; eg egg; ph pharynx; pv prostate vesicle; st stylet; sv seminal vesicle. Scale bars: 200 μm (A); 50 μm (B–F).

According to the drawings of Papi (1951: figs 32–33) the stylet of this species measures 42–65 µm, which is in the range of our collected specimen. In other populations recorded from Germany, the stylet is 65–77 µm long (Rixen 1961). The most characteristic traits for this species are the distal turn and the dorsal aperture of the stylet; therefore, we identify our specimen as M. rostratum.

Prorhynchida Karling, 1974

Prorhynchidae Hallez, 1894

Prorhynchus Schultze, 1851

Prorhynchus stagnalis Schultze, 1851

Fig. 4

Known distribution

Species with a worldwide distribution, recorded from South America (Brazil) (Marcus 1944; Reyes et al. 2021), North America (Unite States) (Higley 1918; Kenk 1949; Kolasa et al. 1987; Smith 1991; Glasgow 2021), Faroes Islands (Steinböck 1931), West Europe (United Kingdom, Ireland, Sweden, Belgium, Netherlands; Germany, Switzerland, Austria, Poland, Czech Republic, France, Spain) (Schultze 1851; Graff 1882, 1913; Fuhrmann 1894, 1900; Steinböck 1923; Southern 1936; Rixen 1961; Young 1970, 1972, 1973; Kolasa 1971; Farias et al. 1996; Noreña et al. 2007), East Europe (Bulgaria, Hungary, Hungary, North Macedonia-Alvania, Russia) (Graff 1913; Steinböck 1932; An der Lan 1939), Asia (China and Japan) (Okugawa 1953; Peng et al. 2007), and Africa (Kenya) (Young and Young 1976).

Material

Six specimens studied alive, two preserved in ethanol for future molecular analyses, four cut in two pieces, the anterior part containing the stylet for whole mounting (ZMH V13839–13842) and the posterior part preserved for molecular analyses; collected in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep.

Remarks

Animals 2.5–3.5 mm long depending on the contraction stage, opaque, without eyes (Fig. 4A). The oral pore opens at the anterior tip; the pharynx (Fig. 4B, C: ph) is located behind the brain (Fig. 4B: br) and beside the prostate vesicle (Fig. 4B, C: pv), and proximally opens into the intestine (Fig. 4A: i). The intestine of some specimens contained numerous chaetae of oligochaetes; a feeding behaviour previously recorded to the species (Tylet et al. 2018).

Figure 4.

Prorhynchus stagnalis. A. Habitus of a swimming specimen; B–D. Anterior part of the body; E, F. Sclerotised structures. Abbreviations: br brain; eb external bars; i intestine; ib internal bars; ov ovary; ph pharynx; phg pharyngeal glands; pv prostate vesicle; st stylet. Scale bars: 200 μm (A); 100 μm (B–D); 50 μm (E, F).

The ovary (Fig. 4A: ov) is very long and runs medially, extending over the posterior two thirds of the body; eggs were observed. The male reproductive system includes the large unpired testis, located at mid body; the seminal vesicle, located posterior to the pharynx; the prostate vesicle running beside the pharynx; and the armed copulatory organ. The prostate vesicle shows thick muscle walls, perforated by the necks of the extracapsular prostatic glands, containing a coarse-granular secretion. Proximally, the prostate vesicle looks empty, maybe because it contains a very fine secretion. A very large duct connects the prostate vesicle with the armed bulb.

The armed male copulatory organ (Fig. 4D–F) is located in the anterior part of the body, anterior to the brain. It consists of a central stylet (Fig. 4B, D–F: st) surrounded by two concentrical rings of spines. The stylet is 64–68 µm long ( = 66 µm; n = 4), proximally funnel shaped and posteriorly tapering to the distal sharp tip. As described by Tyler et al. (2018), the stylet consist of two pieces, clearly distinguishable in the posterior third of the stylet. In the distal area, only the sharp tip of the stylet (part of the inner tube) could be observed. The number of bars on each ring surrounding the stylet is difficult to observe; however, in two specimens it seems that there are 10 bars in the external and six in the internal ring. This pattern has also been identified in populations from the Unite States and Brazil (Tyler et al. 2018; Reyes et al. 2021). The external bars (Fig. 4D–F: eb) are arched, 53–57 µm long ( = 55 µm; n = 4), proximally broad and posteriorly taper to rounded tips. The internal bars (Fig. 4D, F: ib) appear straight to slightly arched but the rest of their morphology is hardly distinguishable; they are 47–53 µm long ( = 50 µm; n = 4).

It has been proposed that P. stagnalis comprises a complex of species primarily distinguished by variations in the morphology of male sclerotised structures. However, comprehensive morphological and molecular investigations are imperative to elucidate the taxonomy of this species group fully. Furthermore, extensive sampling is required, including the type locality of the species (Greifswald, Germany). The specimens we have examined exhibit the smallest stylet (~66 µm) compared to those documented in the literature from The Urals (100–124 µm; Rogozin 2015), the United States (~90 µm; Tyler et al. 2018), and Brazil (~123 µm; Reyes et al. 2021).

Rhabdocoela Ehrenberg, 1831

Kalyptorhynchia Graff, 1905

Eukalyptorhynchia Meixner, 1928

Polycystididae Graff, 1905

Gyratrix Ehrenberg, 1831

Gyratrix hermaphroditus Ehrenberg, 1831

Fig. 5

Known distribution

This is the microturbellarian species with the widest distribution worldwide (see Artois and Tessens 2008; Diez et al. 2018). However, this distribution corresponds to a puzzle of dozens of cryptic species (Tessens et al. 2021).

Material

Specimens were found in two locations. One specimen was studied alive and preserved in ethanol for future molecular analyses. It was collected in Wandse river, submerged vegetation with organic matter, 0.1 m deep. Fifteen specimens were studied alive, eleven of them whole mounted and four preserved for future molecular analyses collected in Kirchwerder-Fünfhausen, among submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep.

Remarks

The specimen from Wandse river is 1354 µm long and those from Kirchwerder-Fünfhausen are 870–926 µm long ( = 904 µm; n = 6). They are unpigmented, with a pair of eyes (Fig. 5A: e) posterior to the proboscis (Fig. 5A: pr).

Figure 5.

Gyratrix hermaphroditus. A, B. Habitus of a swimming specimen; C–F. Posterior part with sclerotised structures. Abbreviations: b bursa; e eye; ov ovary; ph pharynx; pr proboscis; ps3, ps4 prostate stylet type 3 and 4, respectively; pv prostate vesicle; t testi. Scale bars: 100 μm (A); 50 μm (B–F).

The testis (Fig. 5A, B: t) is located at the left body side, extending from the region of the eyes to about three quarters of body length. Ovary and atrial organs located posteriorly in the body. The prostate stylet type II (Fig. 5B–F: ps2) is 189 µm long in the specimen from Wandse river and 155–169 µm long ( = 164 µm; n = 9) in those from Kirchwerder-Fünfhausen. The prostate stylet type III (Fig. 5B–F: ps3) is 147 µm long in the specimen from Wandse river and 150 µm long ( = 131–167 µm; n = 9) in those from Kirchwerder-Fünfhausen. In the specimens from both localities, the stylet type III distally bifurcates and therefore ends in two opposed tips.

Vitellarium not observed. The ovary (Fig. 5B, C: ov) is kidney shaped in the specimen from Wandse river, with the oocytes organised in a row, increasing in diameter from proximal to distal. In contrary, in the specimens from Kirchwerder-Fünfhausen, the ovary is globular, with oocytes of dissimilar size. The bursa (Fig. 5B–D: b) is located completely posterior and overlaps with the stylets; several masses of sperm in digestion were observed.

Based on our findings, it appears that the specimens collected from the two sampled localities correspond to two distinct species within the G. hermaphroditus complex. These species are distinguishable by differences in the size of the sclerotised male structures and the morphology of the ovary. However, differentiation within this extensive species complex poses significant challenges and warrants molecular investigations. Phylogenetic analyses conducted by Tessens et al. (2021) revealed a remarkable diversity of 62–78 species concealed under the name G. hermaphroditus, with many of them confined to single localities while others are more widely distributed.

The morphology of the hard structures in our specimens appears to align with group H as defined by Tessens et al. (2021), characterised by the bifurcate ending of prostate stylet type III. Notably, this group comprises exclusively freshwater species from Australia. However, molecular studies are essential to validate this morphological resemblance. Specimens from Germany included in the aforementioned phylogenetic study fall into groups A and B (comprising freshwater and brackish species) and group L (marine species). Nonetheless, representatives from the latter three groups exhibit a prostate stylet type III ending in a simple, hook-shaped tip. Future integrative studies are imperative to unravel the intricate taxonomy of the G. hermaphroditus species complex, which should encompass the analysis of specimens from its type locality in Berlin, Germany.

Dalytyphloplanida Willems, Wallberg, Jondelius, Littlewood, Backeljau, Schockaert & Artois, 2006

Neotyphloplanida Willems, Wallberg, Jondelius, Littlewood, Backeljau, Schockaert & Artois, 2006

Limnotyphloplanida Van Steenkiste, Tessens, Willems, Backeljau, Jondelius & Artois, 2013

Dalyelliidae Graff, 1905

Castrella Graff, 1905

Castrella alba Luther, 1955

Figs 6, 7

Known distribution

Species recorded from Finland and Sweden (Luther 1955).

Material

Seven specimens studied alive, two of which were whole mounted afterwards (ZMH V13831–13832); collected in Kirchwerder-Fünfhausen, submerged vegeta­tion and litter in an irrigation channel, 0.1–0.2 m deep. Four specimens studied alive and preserved in absolute ethanol, collected in Groß Glienicker lake; littoral, floating vegetation. Two specimens from Kirchwerder-Fünfhausen and one from Groß Glienicker lake used for molecular phylogenetic analyses.

Remarks

Live specimens about 1 mm long, anterior margin rounded and posterior pointing, translucent, pinkish-brownish colouration due to parenchymal glands (Figs 67). A pair of eyes (Figs 6A–C, 7A: e) anterior to the pharynx; the eyes are formed by two pigmented spots linked by a bridge, and sometimes look like two independent structures. Barrel-shaped pharynx (Figs 6A–C, 7A: ph) 122–183 µm long ( = 147 µm; n = 5). Testes located postero-lateral to the pharynx. The male copulatory organ includes a seminal vesicle (Fig. 7E, F: sv), a prostate vesicle (Fig. 7E, F: sv), and the stylet. The stylet (Figs 6D–F, 7C–F: st) is 43–74 µm long ( = 60 µm; n = 3) and displays a proximal handle and a distal spiny part; a hook-shaped, well-differentiated, largest spine is 14–30 µm long ( = 22 µm; n = 3). The vitellaria (Fig. 6B: vi) run beside the pharynx until the posterior third of the body, fusing before opening into the oviduct. The oval eggs are 64–120 µm long (n = 2) and present a 95–168 µm long stalk (n = 2) (Fig. 7A–C: eg).

Figure 6.

Castrella alba Luther, 1955 collected in Hamburg. A, B. Habitus of a swimming specimen; C. Details of the anterior part of the body; D–F. Posterior part of the body with atrial structures. e eye; ov ovary; ph pharynx; st stylet; vi vitellaria. Scale bars: 50 μm.

Figure 7.

Castrella alba Luther, 1955 collected in Brandenburg. A. Habitus of a swimming specimen; B. Details of an egg and its stalk; C. Details of an egg and the stylet; D–F. Posterior part of the body with atrial structures. e eye; eg egg; egs egg stalk; ph pharynx; st stylet; vi vitellaria. Scale bars: 50 μm.

As noted by Luther (1955), identifying the male sclerotised apparatus in C. alba is particularly challenging. In our study, we were able to distinguish a fully developed stylet in only three out of 11 specimens, while this structure was indistinguishable in the whole mounted material. The stylet in this species is generally delicate and, at first glance, appears underdeveloped. Consequently, Luther (1955) speculated that this species might be synonymous with C. vernalis Beklemischev, 1921. However, the newly studied material, which includes fully developed specimens, suggests that C. alba bears a closer resemblance to C. truncata (Abildgaard, 1789) Sekera, 1906, as indicated by the stylet, which has a proximal handle and a distal spiny section with one spine more developed than the others. Nevertheless, our phylogenetic analysis confirms that C. alba represents a distinct lineage from C. truncata (see section Molecular Phylogenetic Analyses; Fig. 16).

Microdalyellia Gieysztor, 1938

Microdalyellia armigera (Schmidt, 1862) Gieysztor, 1938

Fig. 8

Known distribution

This species has been broadly recorded in the United States, Iceland, Faroe Islands, overall Europe (United Kingdom, Ireland, Finland, Belgium, Germany, Austria, Switzerland, Czech Republic, Poland, Romania, Bulgaria, Latvia, Italy, France, and Spain), Russia, and Japan. See a summary of this distribution and main references in Van Steenkiste et al. (2011).

Material

One specimen studied alive and whole mounted (ZMH 13833), collected in Wandse river, submerged vegetation with organic matter, 0.1 m deep.

Remarks

Live animal about 1 mm long, anterior margin rounded and posterior pointing, translucent, orange colouration due to parenchymal glands (Fig. 8A). A pair (Fig. 8A: e) of eyes anterior to the pharynx. Barrel-shaped pharynx (Fig. 8A: ph) 250 µm long. Testes located antero-lateral to the male copulatory bulb. This bulb encompasses a seminal vesicle (Fig. 8B: sv), a prostate vesicle (Fig. 8B: sv), and the stylet. The stylet (Fig. 8C–E: st) is 123 µm long, H-shaped as typical for species of Microdalyellia. One arm carries five 17-µm-long spines, and the other a single 58-µm-long spine. The vitellaria (Fig. 8A: vi) run beside the pharynx until the posterior third of the body, fusing before opening into the oviduct. The oval egg is 140 µm long (Fig. 8A, C–F: eg).

Figure 8.

Microdalyellia armigera. A. Habitus of a swimming specimen; B. Seminal and prostate vesicles; C–F. Male stylet. e eye; eg egg; i intestine lumen; ph pharynx; pv prostate vesicle; st stylet; sv seminal vesicle; vi vitellaria. Scale bars: 100 μm (A); 50 μm (B–F).

Microdalyellia armigera shows a high morphological variability of the male sclerotised stylet, the main character to differentiate species in most microturbellarians. However, it would not be surprising if this variability represents cryptic speciation, as suggested by our phylogenetic analysis (see section Molecular Phylogenetic Analyses; Fig. 16). For example, the specimens of M. armigera collected by Müller and Faubel (1993) in the Elbe river present a stylet much larger than in our specimen (220 µm vs 123 µm respectively) and have 3–9 spines in one arm. The size of this structure in other North-European populations varies between 82 μm and 130 μm (Luther 1955; Rixen 1961) and in specimens from Spain is 165 μm long (Van Steenkiste et al. 2011). In general the number of spines in both arms can be variable (see Luther 1955; Bauchhenss 1971) but commonly there is one arm with one spine and the other with 4–5 (Müller and Faubel 1993).

Microdalyellia schmidtii (Graff, 1882) Gieysztor, 1938

Figs 9, 10

Known distribution

Species with a known distribution in West Europe (United Kingdom, Finland, Germany, and Switzerland) (Graff 1882, 1913; Fuhrmann 1894; Luther 1955; Rixen 1961; Young 1970), and Russia (Nasonov 1919, 1926).

Material

Observations on eight live animals, five whole mounted afterwards (ZMH 13834–13838) and the other three preserved in absolute ethanol (two already sequenced for molecular analyses); collected in Wittenberg, Rissen, on tree holes filled with water and litter, 20–50 cm over the ground level.

Remarks

Animals 704–1010 µm long ( = 840 µm; n = 3), with a pair of eyes (Fig. 9A: e) anterior to the pharynx. The yellowish to orange colouration is due to parenchymal glands. The barrel-shaped pharynx (Fig. 9A: ph) is 231–289 µm long ( = 262 µm; n = 3), when the animal is not contracted.

Figure 9.

Microdalyellia schmidtii. A. Habitus of a swimming specimen; B, C. Male atrial organs; D. Ovary; E, F. Male stylet. Scale bars: 100 μm (A); 50 μm (B–F).

The atrial organs are located in the posterior body third. The pair of testes (Fig. 9B, C: t) is located beside the male copulatory organ. The copulatory organ encompasses a seminal vesicle (Fig. 9B, C: sv), a prostatic vesicle (Fig. 9B, C: pv), and the stylet. The stylet (Figs 9B, C: st, E, F, 10) is 147–151 µm long ( = 149 µm; n = 4) and each arm is armed with a conical spine. The larger spine is 64–75 µm long ( = 69 µm; n = 4) and the smaller is 48–52 µm long ( = 50 µm; n = 4), both with the distal tip bent outside and hook shaped. Each vitellarium (Fig. 9A: vi) runs beside the pharynx until the posterior third of the body, and fuses before entering the oviduct. The ovary (Fig. 9D: ov) is 157–212 µm long ( = 185 µm; n = 2). The distal most three oocytes are of similar size and organised in a row, the rest of the ovary is full of smaller oocytes with different degrees of development. The eggs (Fig. 9A: ov) are oval, 148–206 µm long ( = 177 µm; n = 4).

Around 44 species of Microdalyellia have been recorded globally (Tyler et al. 2006–2024). Among them, M. schmidtii stands out as the only one possessing a single, funnel-shaped spine on each arm of the stylet, leading to its stylet being described as ‘plow-shaped’ (Graff 1882; Luther 1955). However, doubts have been raised regarding the validity of this species due to its similarity to M. armigera and M. kupelwieseri (Meixner 1915; Ruebush and Hayes 1939). It has been suggested that M. schmidtii and M. kupelwieseri might be forms of M. armigera with a greatly reduced number of spines (Luther 1955; Young 1970).

Nasonov (1919, 1926) provides insight into the close relationship among the previously mentioned species, particularly in Russian populations. Some specimens of M. schmidtii from Russia (Nasonov 1919: fig. 8) resemble M. kupelwieseri due to the presence of a few smaller spines alongside the main spine of one arm (see Meixner 1915; Luther 1955; Young 1970). However, Nasonov (1926) also recorded specimens of M. schmidtii with a single spine per arm, some displaying transitional forms between extreme morphologies of M. schmidtii and M. armigera. Nevertheless, populations of M. kupelwieseri from Germany (Rixen 1961), the United Kingdom (Young 1970), and Spain (Farías et al. 1995) show morphological convergence, with stylets measuring 100–110 µm and carrying one spine in one arm and three in the other.

The Hamburg population of M. schmidtii is notable for its significantly larger stylet (140 µm) compared to other recorded populations: 92 µm in the United Kingdom (Young 1970), 66 µm in Finland (Luther 1955), and 100 µm in Germany (Rixen 1961). Stylet sizes in M. kupelwieseri populations are also smaller (100–110 µm). The stylet in the new studied material l (ZMH V13848– V13856) of M. kupelwieseri populations displays a triangular spine in the bridge linking the two branches of the stylet (Fig. 11B, D: sp), a structure lacking in both M. schmidtii and M. armigera. In addition, one of the spiny arms of M. kupelwieseri carries three spines, whereas the number is always one in M. schmidtii from Hamburg. We suspect, therefore, that the high similarity between the two species and the sympatric distribution of both in some localities, contributed with their misidentification. Indeed, the re-examination of two specimens identified as M. kupelwieseri collected in Belgium and stored in the reference collection of Hasselt University (VII.4.20 and VII.4.24) allowed their reclassification as M. schmidtii. This action is made considering that their stylets lack a triangular spine in the bridge. A third specimen collected in Belgium, together the two previously mentioned, and sharing the same morphology, was included in the phylogenetic analysis by Van Steenkiste et al. (2013) and it clustered in our phylogeny with specimens of M. schmidtii collected in Hamburg (see section Molecular Phylogenetic Analyses; Fig. 16). These findings support that the presence or not, of a triangular spine in the stylet’s bridge is a diagnostic character for M. kupelwieseri and M. schmidtii, respectively.

Figure 10.

Microdalyellia schmidtii. A–F. Male stylet. Scale bars: 50 μm (A–F).

Figure 11.

Microdalyellia kupelwieseri. A–F. Male stylet; D. Detail of the bridge’s spine; E–F. Detail of the spiny branches. Scale bars: 50 μm (A–F).

Until now, the relationships among M. armigera, M. kupelwieseri, and M. schmidtii, and the validity of the latter two species, remained unclear. However, it is suggested that the group M. kupelwieserischmidtii can be distinguished from M. armigera by the reduced spine number in one arm, as well as the larger size of the single spines in M. schmidtii and the main spines of M. kupelwieseri compared to those in M. armigera. In this sense, our phylogenetic analysis contributed to clarify that the three species represent distinct lineages and support their validity. However, M. armigera could represent a complex of cryptic species (see section Molecular Phylogenetic Analyses; Fig. 16).

Typhloplanidae Graff, 1905

Krumbachia Reisinger, 1924

Krumbachia hiemalis Schwank, 1979

Fig. 12

Known distribution

Until now, this species was only known from its type locality in Schlitz, Hessen, Germany (Schwank 1979).

Material

Sixteen specimens studied alive, five of them whole mounted (ZMH V13843–13847), nine preserved for future histological, and two used for molecular studies. Animals collected in Wittenberg, Rissen, on tree holes filled with water and litter, 20–50 cm over the ground level.

Description

Live animals 1.5–2 mm long, unpigmented and without eyes (Fig. 12A). Strong adhenal rhabdite tracts (Fig. 12B: ar) open in the anterior body end. Body oval-elongated, with the anterior margin broader than the posterior. The pharynx (Fig. 12A, C: ph) is located about midbody, 285 µm in diameter (all provided measures of this species are based on a single living specimen).

Figure 12.

Krumbachia hiemalis. A. Habitus of live specimens; B. Anterior region; C. Posterior region; D, E. Atrial organs. Scale bars: 50 μm (B–E).

The testes (Fig. 12A: t) are located anterior and the ovary and atrial organs posterior to the pharynx. The male copulatory organ (Fig. 12A, C: mco) is 156 µm long and encompasses a seminal vesicle, a prostate vesicle, the sclerotised ejaculatory duct, and a bundle of accessory glands. The seminal vesicle (Fig. 12D, E: sv) receives independently both spermatic ducts and, then, opens into the prostate vesicle. The prostate vesicle (Fig. 12D, E: pv) contains a granular secretion, also observable throughout the ejaculatory duct. The ejaculatory duct (Fig. 12D, E: ed) is 102 µm long, with slightly sclerotised walls (not observable on the whole mounts). The distal half of the male copualatory bulb is occupied by a mass of accessory glands (Fig. 12D, E: gl), surrounding the ejaculatory duct.

The vitellaria (Fig. 12A: vi) extend at the body sides, between the brain and the posterior part of the body. The ovary (Fig. 12A, C: ov) is 152 µm long, with the oocytes increasing in diameter from proximal to distal. The female duct connects the ovary to the female atrium. A seminal reservoir (Fig. 12A: sr) opens into the female duct (no sperm observed in this structure). The bursa (Fig. 12A, C–E: b) opens into the common general atrium in between the apertures of the female and male atria. Several vesicles were observed within the bursa but no sperm.

The morphology of the specimens collected in Hamburg closely aligns with the description outlined by Schwank (1979). For specimens from the type locality, the copulatory bulb length falls within the range of 120–180 µm. Additionally, Schwank (1979) noted the proximal oblique opening of the sclerotized duct in this species, a characteristic clearly observable in our recently collected specimens. This species stands out from all others within the genus Krumbachia due to the distinctive combination of a two-layered cuticularised ejaculatory duct, notable for its high mobility, and a bursa characterised by a remarkably thin wall.

Tricladida Lang, 1884

Continenticola Carranza, Littlewood, Clough, Ruiz-Trillo, Baguna & Riutort, 1998

Planarioidea Stimpson, 1857

Planariidae Stimpson, 1857

Planaria Müller, 1776

Planaria torva (Müller, 1773) Müller, 1776

Fig. 13

Known distribution

Species broadly distributed in West Europe (United Kingdom, Ireland, Belgium, Finland, Sweden, Denmark, Germany, Greece, France, and Italy) (Arndt 1926; Luther 1961; Ronneberger 1975; Ball and Reynoldson 1981; Müller and Faubel 1993; Martin and Brunke 2012), East Europe (Estonia, Latvia, Littauen, Ukraine, Poland, and Czech Republic) (Luther 1961; Pinchuk 1979), and Russia (Grimm 1877; Luther 1961).

Material

Six specimens studied alive and preserved in absolute ethanol for future molecular analyses; one collected in Wandse river, submerged vegetation with organic matter, 0.1 m deep; one in Planten un Blomen park, submerged litter, 0.3 m deep; and four in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep.

Remarks

Live adult specimens measuring 0.5–1.5 cm, dark pigmented, with a pair of anterior eyes (Fig. 13A–C: e). Squeezed specimens show the pharynx and atrial organs. The pharynx (Fig. 13C, D: ph) is located in the second body half and the mouth opens anterior to the male copulatory organ (Fig. 13A, C, D: mco). The seminal ducts form false seminal vesicles (Fig. 13A, C, D: fsv) beside the anterior part of the pharynx. The male copulatory organ receives medially, independently, both seminal ducts, which evacuate the sperm in a single proximal seminal vesicle. Distally, the bulb forms a muscular penial papilla. One adenodactyl (Fig. 13C, D: ad) opens into the common atrium, at the right side of the male bulb; it is oriented backwards. The adenodactyl is distally bent and the central lumen makes it look hollow. The single observed structure of the female system was the bursa (Fig. 13D: b), located to the right side of the male organ.

Figure 13.

Planaria torva. A. Habitus of swimming specimen; B–D. Squeezed specimen.

Planaria torva is a species widely distributed throughout West Europe, and it is frequently mentioned in taxonomic literature on triclads in the region. However, accurate identification of this species can be challenging without a detailed examination of internal morphology. The taxonomic history of P. torva has been contentious, with several studies mistakenly associating it with species of Dugesia (Ball et al. 1969). In light of these issues, we based the identification of our specimens on descriptions provided by Luther (1961) and Ball et al. (1969). The presence of an adenodactyl serves as a key distinguishing feature between our studied specimens of P. torva and species of Dugesia (Luther 1961). Furthermore, the overall structure of the atrial organs in our specimens, particularly the male bulb and the adenodactyl, unequivocally supports their classification within P. torva. For a more comprehensive comparison of this species with related congeners, refer to Ball et al. (1969).

Polycelis Ehrenberg, 1831

Polycelis tenuis Ijima, 1884

Fig. 14

Known distribution

Species recorded from The Netherlands (Young 1972), Finland, United Kingdom and Ireland (Luther 1961), Gernany (Schwank 1981; Martin and Brunke 2012), Macedonia (Kenk 1978), Romania (Felicia 2018), and Russia (Luther 1961).

Material

Six specimens studied alive, preserved in absolute ethanol for future molecular analyses; collected in Kirchwerder-Fünfhausen, submerged vegetation and litter in an irrigation channel, 0.1–0.2 m deep.

Remarks

Mature specimens measuring 0.5–1.2 mm, dark coloured (Fig. 14A, B). Marginal eyes (Fig. 14C, D: e) distributed over the anterior third of the body. The pharynx (Fig. 14B, C) is located over the midbody and the mouth (Fig. 14C, E: m) opens anterior to the male copulatory organ. The male copulatory organ (Fig. 14B, E: mco) is 940–1100 µm long (n = 1; varying according to the relaxing stage) and 620 µm at widest. The male organ is spiny over its distal 300–480 µm, and forms a penial papilla (Fig. 14E: pp). The spines (Fig. 14F) are 17–18 µm long (n = 10). Two adenodactyls (Fig. 14E: ad) are located posterior to the male bulb and open into the common atrium, oriented forward, and exhibiting a glandular lumen.

Figure 14.

Polycelis tenuis. A. Habitus of swimming adult specimen; B. Squeezed adult specimen; C, D. Squeezed juvenile; E. Atrial organs; F. Spines of the penial papilla. Scale bars: 200 μm (D); 600 μm (E); 100 μm (F).

Three species of Polycelis have been documented in Germany, and they are widespread across Europe: P. felina, P. nigra, and P. tenuis (Volk 1903; Ronneberger 1975; Schwank 1981; Müller and Faubel 1993). Among these, only P. nigra has been reported in Hamburg (Volk 1903). Species within the genus Polycelis are primarily distinguished by the structure of the male bulb and adenodactyls. Polycelis tenuis shares with P. felina the presence of two adenodactyls, structures absent in P. nigra. However, P. felina is easily identifiable by the presence of two tentacles in its anterior body region. The penial papilla of P. tenuis is armed with spines along its distal half, whereas P. nigra exhibits two to three spine rows distally, and P. felina lacks any spines in this region (Hansen-Melander et al. 1954; Luther 1961; Harrath et al. 2012). Volk (1903) did not provide detailed morphological information about the specimens of P. nigra recorded in Hamburg. Given the necessity of studying the morphology of atrial organs for accurate identification of these triclads, this record requires confirmation.

Molecular phylogenetic analyses

Catenulida

The dataset of Catenulida included sequences of 56 specimens, representing at least 14 species of Stenostomum and two outgroups. Eight of these specimens were sequenced for the present study. After removing ambiguously aligned positions, the 18S, 28S rDNA, and COI mDNA alignments were 1612, 1473 and 553 bp long, respectively, resulting in a concatenated alignment of 3615 bp. Bayesian and ML topologies were congruent after collapsing of weakly supported clades. The resulting phylogeny of the analysis is shown in Fig. 15.

Figure 15.

Majority-rule consensus tree from the Bayesian analysis of the concatenated 18S + 28S rDNA + COI mDNA dataset of Stenostomum, Catenulida. Branches with support values below the thresholds in the legend of the three analyses were collapsed. Support values are represented in the order of posterior probabilities / SH-aLRT / ultrafast bootstrap. Branches without symbols have pp = 1, SH-aLRT = 100, and UFboot = 100. Taxa from which new sequences were obtained for this study are highlighted in bold.

All species of Stenostomum cluster in a highly supported clade (pp = 1; SH-aLRT = 98.8; UFboot = 98). Stenostomum arevaloi resulted as the sister to all other species of the genus included in the analysis (pp = 0.99; SH-aLRT = 47.5; UFboot = 63). Species within this large clade cluster into two groups, one containing Stenostomum handoelense, S. saliens, S. tuberculosum, S. heenuktense, and S. steveoi (pp = 1; SH-aLRT = 95.4; UFboot = 90); and the other (pp = 1; SH-aLRT = 79.6; UFboot = 82) including three subgroups: S. grabbskogense + S. bryophilum (pp = 1; SH-aLRT = 99.9; UFboot = 100), S. leucops + S. grande + S. leucops aquariorum (pp = 1; SH-aLRT = 96.4; UFboot = 96), and S. simplex + S. sphagnetorum + S. gotlandense (pp = 1; SH-aLRT = 100; UFboot = 100). The specimens of S. tuberculosum form two distinct clades within a polytomy with S. saliens (pp = 1; SH-aLRT = 67.3; UFboot = 79). Specimens of S. leucops form four lineages: one including specimens from Germany and Sweden (pp = 0.84; SH-aLRT = 100; UFboot = 99), and the others corresponding to single specimens from Finland (S. leucops and S. leucops aquariorum) and Brazil. One specimen of S. grande from Japan and three specimens of an unidentified species from Germany cluster together (pp = 0.91; SH-aLRT = 100; UFboot = 96) and this clade is sister to that including the specimens of S. leucops from Sweden and Germany (pp = 0.84; SH-aLRT = 80.7; UFboot = 85).

Stenostomum simplex forms two clades, one including specimens from Japan (Japan 3 and 4 in Fig. 15) (pp = 1; SH-aLRT = 93; UFboot = 98) and the other including specimens from Japan (Japan 1 and 2) and Germany (pp = 1; SH-aLRT = 99.6; UFboot = 100). This last group of S. simplex is sister to S. sphagnetorum + S. gotlandense (pp = 0.99; SH-aLRT = 96.7; UFboot = 92). Stenostomum gotlandense includes specimens from Germany and Sweden (pp = 1; SH-aLRT = 93.7; UFboot = 96).

Rhabdocoela

The dataset of Rhabdocoela included sequences of 97 specimens, representing 84 species. Ten of these specimens were sequenced for the present study. After removing ambiguously aligned positions, the 18S and 28S rDNA alignments were 1793 and 1743 bp long, respectively (concatenated alignment of 3536 bp). Bayesian and ML topologies were congruent after collapsing of weakly supported clades. The resulting phylogeny of the analysis is shown in Fig. 16.

Figure 16.

Majority-rule consensus tree from the Bayesian analysis of the concatenated 18S + 28S rDNA dataset of Rhabdocoela. Branches with support values below the thresholds in the legend of the three analyses were collapsed. Support values are represented in the order of posterior probabilities / SH-aLRT / ultrafast bootstrap. Branches without symbols have pp = 1, SH-aLRT = 100, and UFboot = 100. Taxa from which new sequences were obtained for this study are highlighted in bold.

As previously shown by Van Steenkiste et al. (2013), both ‘Typhloplanidae’ (pp = 1; SH-aLRT = 99.5; UFboot = 100) and Dalyelliidae (pp = 1; SH-aLRT = 100; UFboot = 100) form two highly supported clades (Fig. 16). Within ‘Typhloplanidae’, our newly generated sequences of Krumbachia hiemalis cluster together with Krumbachia sp. and provide the first molecular support for the monophyly of the genus (pp = 1; SH-aLRT = 99.8; UFboot = 100). Otherwise, the genera Mesostoma, Bothromesostoma, Phaenocora, Olisthanella, and Castrada were recovered as paraphyletic. Three sequenced specimens of Bothromesostoma, two of them identified as B. personatum, are deeply embedded within Mesostoma. Specimens of Mesostoma lingua do not form a monophyletic clade.

Species of Castrella cluster in a fully supported clade (pp = 1; SH-aLRT = 100; UFboot = 100) which is the sister taxon to all other dalyelliids (pp = 1; SH-aLRT = 100; UFboot = 100). Three specimens of C. alba cluster together (pp = 1; SH-aLRT = 89.3; UFboot = 100) and form an unresolved group with C. truncata from Switzerland and C. pinguis + C. truncata from Canada (pp = 94; SH-aLRT = 87.7; UFboot = 98). Therefore, this analysis revealed the existence of cryptic diversity within C. truncata, containing, at least, an European and a North American lineages.

The second clade within Dalyelliidae forms a polytomy including the groups of most species of Gieysztoria (pp = 1; SH-aLRT = 100; UFboot = 100), species of Dalyellia + Pseudodalyellia alabamensis (pp = 1; SH-aLRT = 92.6; UFboot = 98), Dalyellidae n. gen. n. sp. + Gieysztoria cf. billabongensis (pp = 1; SH-aLRT = 100; UFboot = 100), and species of Microdalyellia (pp = 1; SH-aLRT = 100; UFboot = 100). The interrelationships of two analysed specimens of M. armigera are not fully resolved. Otherwise, specimens of M. kupelwieseri and M. schmidtii cluster together (pp = 1; SH-aLRT = 98.8; UFboot = 99). One specimen of M. schmidtii, collected in Belgium, clusters with two specimens of the same species collected in Hamburg (pp = 0.97; SH-aLRT = 79.7; UFboot = 99) and together are sister to a clade containing two specimens of M. kupelwieseri collected in Basel, Switzerland (pp = 1; SH-aLRT = 96.6; UFboot = 100).

Discussion

There is no doubt that Germany boasts one of the most thoroughly researched and understood diversities of turbellarians worldwide. However, the distributional knowledge of this diversity varies significantly among different regions within Germany. Consequently, it is not uncommon to encounter new species records in areas with relatively limited sampling efforts. Undoubtedly, the sparse studies conducted in Hamburg and the limited number of species recorded highlight this region as poorly explored in terms of turbellarian diversity within Germany. It is necessary to emphasize the rich diversity of freshwater turbellarians found in urban and suburban environments of Hamburg, evidencing their importance for conservation. Particularly, the shallow irrigation ditch sampled in Kirchwerder-Fünfhausen hosted the highest found richness with eight species. Therefore, we suspect that a much higher diversity can be detected in a broader collecting campaign.

Our discoveries have led to the record of two already known catenulids for Germany, Stenostomun gotlandense and S. simplex. A third species, provisionally identified as Stenostomum sp., is related to Japanese specimens of S. grande (see Fig. 15), a species not recorded from Germany. Stenostomum represents a genus of turbellarians that remains poorly studied and encompasses several taxa in need of revision, likely containing cryptic species. Therefore, the information we have provided on German species of Stenostomum holds significance for future investigations into these species.

For instance, our study supports previous findings (i.e. Rosa et al. 2015) suggesting that S. leucops and S. grande represent two complexes of cryptic species, a proposition supported by the morphological variability observed in our examined specimens compared to those documented in the literature. As such, S. grande is represented in our study by two lineages, one from Brazil and the other including specimens from Germany and Japan. Within the four lineages representing specimens of S. leucops, one is morphologically remarkable, S. leucops aquariorum. This subspecies was described by Luther (1960) from Helsinki, Finland, and is diagnosable by a reduced number of spherules (6–10) contained in the refractile bodies, whereas there are more than 20 in the nominal species. Consequently, given the importance of the refractile bodies’ morphology to differentiate catenulid species and the evidences of our phylogenetic analysis, we propose to recognise S. leucops aquariorum as a distinct and valid species of Stenostomum, now S. aquariorum stat. nov. (for the description of the species see Luther 1960).

The cryptic diversity observed within the S. leucopsS. grande group appears to also apply to S. simplex. Specimens of S. simplex from Japan do not form a monophyletic clade, with two of them clustering alongside a specimen from Germany. As a result, our identification of the German specimen as S. simplex is provisional and requires further confirmation through more extensive morphological and phylogenetic analyses. The type localities of the three species discussed here—S. leucops, S. grande, and S. simplex—are all located in the United States. Therefore, studying specimens from their type localities is crucial to accurately delineate species boundaries. In contrast, S. tuberculosum shows a different pattern, with two distinct clusters emerging from our analysis. This divergence may be influenced, and potentially artificially generated, by the fact that two specimens are represented by partial 18S rDNA sequences (Japan 3 and 4), while the other two are represented by partial COI mDNA sequences (Japan 1 and 2).

Similarly, as occurs with species of Stenostomum, Prorhynchus stagnalis represents another case of cryptic diversity (Tyler et al. 2018; Reyes et al. 2021), evidenced in the size variability of the stylet in the different studied populations. Furthermore, the German populations of Gyratrix hermaphroditus warrant scrutiny in light of the findings by Tessens et al. (2021), who revealed this species as the largest known case of cryptic diversity among microturbellarians. Specifically, a re-evaluation of specimens from the type locality (Berlin) is highly recommended before proceeding with the description of additional species.

Our phylogenetic analysis suggests that Bothromesostoma should be synonymized with Mesostoma. Braun (1885) distinguished these two genera based on the morphology of the testes and the presence of a ventral, epidermal follicle (“Hautfollikel”): species of Mesostoma were characterised by two compact testes and the absence of a follicle, whereas species of Bothromesostoma had follicular testes and a ventral, epidermal follicle (“glandular sac” as termed by Marcus 1946, 1960). However, these traits appear to have evolved or been lost multiple times within the group. For instance, M. macroprostatum Hyman, 1939 also exhibits a glandular sac anterior to the pharynx. Marcus (1955) additionally noted that species of Bothromesostoma possess a spermatic duct between the bursal canal and the female genital canal, a structure absent in other mesostomids, which are classified under Mesostoma. Nevertheless, he also recognised significant variability in other morphological features within Mesostoma. Thus, the presence of a spermatic duct and glandular sac may simply reflect interspecific variation within Mesostoma, rather than defining features of distinct genera. Our phylogenetic analysis also revealed the presence of cryptic diversity within this group, identifying two distinct lineages of B. personatum and three of M. lingua. However, this observed cryptic diversity may be attributed to misidentification, given the highly homogeneous external morphology of these species. A similar situation, potentially involving either cryptic diversity or species misidentification, was noted in the two lineages of Olisthanella truncula and Phaenocora that were recovered in our analysis.

Hamburg specimens of Microdalyellia schmidtii stand out due to their stylet morphology, notably larger than that found in other populations of the species and its closely related counterpart M. kupelwieseri. Specimens of M. schmidtii were discovered alongside Krumbachia hiemalis in phytotelmata, which are tree holes containing water, a habitat that has received relatively little exploration in terms of meiofauna diversity (see Majdi et al. 2024). Since turbellarians inhabit a wide range of aquatic and limnoterrestrial ecosystems, it is crucial to include phytotelmata in studies, as these habitats likely host a diverse array of species. Furthermore, our examination of specimens of K. hiemalis marks only the second recorded instance of the species since its initial description by Schwank (1979).

Our developed phylogenetic analysis illuminated the previously questioned validity of M. schmidtii and M. kupelwieseri, two species suggested as forms of M. armigera. Clearly, M. armigera forms distinct lineages with respect to the other two species, and, at the same time, seems to contain more than one species due to the different Finnish and Spanish lineages. Therefore, considering the broad distribution of M. armigera and the high morphological variability recorded for its populations (regarding the stylet size and spines number and size), it is indispensable to conduct a broad and integrative taxonomical study to clarify its diversity. On the other hand, the well-supported clades of M. schmidtii and M. kupelwieseri are morphologically diagnosable due to the spine present in the stylet’s bridge of M. kupelwieseri, a structure missing in M. schmidtii.

Freshwater triclads have been extensively studied across Europe but recent studies revealed several undescribed species, particularly of Dugesia, and a complex biogeographical and evolutionary history (Benítez-Álvarez et al. 2023; Dols-Serrate et al. 2023). However, the two triclads we collected in Hamburg have a history of misidentification due to the lack of studies on their internal morphology. Identifying these species without examining their copulatory organs is nearly impossible and has proven to be detrimental, leading to numerous unnecessary taxonomic challenges. Therefore, confirming the distribution of Polycelis nigra in Hamburg requires examining fresh material, as Volk (1903) did not provide morphological evidence for its classification. In fact, the species we found in Hamburg is P. tenuis, easily distinguishable by the presence of two adenodactyls and the spiny armature of the male copulatory organ.

In summary, our study sheds light on the complex and understudied diversity of turbellarians in Germany, particularly in Hamburg, where limited sampling has resulted in sparse species records. Our findings highlight the cryptic diversity within several genera, including Stenostomum, Mesostoma, and Microdalyellia, as well as the need for further research to clarify taxonomic boundaries, particularly in species with highly homogeneous morphologies. The morphological variability observed within Stenostomum leucops, S. grande, and S. simplex supports the existence of cryptic species, reinforcing the importance of comprehensive phylogenetic and morphological analyses, including studies of specimens from type localities. Additionally, our identification of Microdalyellia schmidtii and Krumbachia hiemalis in Hamburg’s unique phytotelmata habitats emphasizes the importance of exploring diverse aquatic environments to better understand the true extent of turbellarian diversity. Lastly, the need for accurate species identification through detailed morphological examination, as demonstrated in the case of Polycelis nigra and P. tenuis, remains critical for avoiding taxonomic misinterpretation and advancing the knowledge of freshwater turbellarian biodiversity in Germany and beyond.

Acknowledgements

Nancy F. Mercado-Salas and Marlies Monnens are thanked by their invaluable help with the phylogenetic analyses. We thank Lukas Schärer (Basel University, Switzerland) for helping with the identification of Macrostomum rostratum and the collecting in Basel. YLD is supported by a Georg Forster Research Fellowship (Alexander von Humboldt Foundation, Germany, grant number 3.2 - CUB - 1226121 - GF-P). We extend our gratitude to Tom Artois (Hasselt University, Belgium) for his valuable input on the identification of Microdalyellia schmidtii. Yusdiel Torres-Cambas provided assistance with specimen collection in Brandenburg.

References

  • An der Lan H (1939) Zur rhabdocoelen Turbellarienfauna des Ochridasees (Balkan). Abhandlungen der Mathematisch-Naturwissenschaftlichen Klasse 148(5–6): 195–254.
  • Armonies W (2018) Uncharted biodiversity in the marine benthos: the void of the smallish with description of ten new Platyhelminth taxa from the well-studied North Sea. Helgoland Marine Research 72: 1–29. https://doi.org/10.1186/s10152-018-0520-8
  • Armonies W (2023) Platyhelminth fauna of the Island of Sylt: a meta-analysis of distributional patterns and description of 19 new species. Marine Biodiversity 53(1): 1–49. https://doi.org/10.1007/s12526-022-01309-w
  • Arndt W (1926) Beiträge zur Kenntnis der Land- und Süsswasserfauna Korsikas. I. Ergebnisse der Dr. Paul Schottlander-Lehrexpedition des Jahres 1914. 2. Turbellaria. Mitteilungen aus dem Zoologischen Museum in Berlin 12(2): 218–222.
  • Artois TJ, Schockaert ER (2003) Primary homology assessment in the male atrial system of the Polycystididae (Platyhelminthes : Eukalyptorhynchia). Zoologischer Anzeiger 242(2): 179–190. https://doi.org/10.1078/0044-5231-00095
  • Artois TJ, Tessens BS (2008) Polycystididae (Rhabditophora: Rhabdocoela: Kalyptorhynchia) from the Indian Ocean, with the description of twelve species. Zootaxa 1849: 1–27. https://doi.org/10.11646/zootaxa.1849.1.1
  • Ax P (1957) Die Einwanderung mariner Elemente der Mikrofauna in das limnische Mesopsammal der Elbe. Zoologischer Anzeiger 50: 428–435.
  • Ball IR, Reynoldson RB (1981) British Planarians. Platyhelminthes: Tricladida. Key and notes for the identification of the species. Synopses of the British Fauna 19. Cambridge University Press, London, 141 pp.
  • Ball IR, Reynoldson TB, Warwick T (1969) The taxonomy, habitat and distribution of the freshwater triclad Planaria torva (Plathelminthes: Turbellaria) in Britain. Journal of Zoology, London 157: 99–123. https://doi.org/10.1111/j.1469-7998.1969.tb01691.x
  • Bauchhenss J (1971) Die Kleinturbellarien Frankens. Ein Beitrag zur Systematik und Ökologie der Turbellaria excl. Tricladida in Süddeutschland. Internationale Revue der gesamten Hydrobiologie und Hydrographie 56: 609–666. https://doi.org/10.1002/iroh.19710560407
  • Behörde für Umwelt, Klima, Energie und Agrarwirtschaft – Abteilung Naturschutz Hamburg (2024) Hamburgs Naturschutzgebiete. Freien und Hansestadt Hamburg, Hamburg.
  • Benítez-Álvarez L, Leria L, Fernández R, Mateos E, El Ouanighi Y, Bennas N, Yacoubi-Khebiza M, Ougougda HA, Riutort M (2023a) Phylotranscriptomics interrogation uncovers a complex evolutionary history for the planarian genus Dugesia (Platyhelminthes, Tricladida) in the Western Mediterranean. Molecular Phylogenetics and Evolution 178: 107649. https://doi.org/10.1016/j.ympev.2022.107649
  • Benítez-Álvarez L, Leria L, Sluys R, Leal-Zanchet AM, Riutort M (2023b) Niche modelling and molecular phylogenetics unravel the colonisation biology of three species of the freshwater planarian genus Girardia (Platyhelminthes, Tricladida). Hydrobiologia 850(14): 3125–3142. https://doi.org/10.1007/s10750-023-05239-x
  • Brand JN (2023) Support for a radiation of free-living flatworms in the African Great Lakes region and the description of five new Macrostomum species. Frontiers in Zoology 20: 31. https://doi.org/10.1186/s12983-023-00509-9
  • Braun M (1885) Die Rhabdocoeliden Turbullarien Livlands. Archiv für die Naturkunde Liv-, Ehst- und Kurlands, Serie 2, 10(2): 131–251.
  • Bruns D, Stemmer B (2018) Landscape assessment in Germany. In: Fairclough G, Herlin IS, Swanwick C (Eds) Routledge Handbook of Landscape Character Assessment: Current Approaches to Characterisation and Assessment. Routledge, UK, 154–167. https://doi.org/10.4324/9781315753423-12
  • Caspers H (1953) Die Bodentierwelt und Biologie des Hamburger Alsterbeckens und der Stadtkanäle. Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut 52: 9–60.
  • Damborenea C, Brusa F, Almagro I, Noreña C (2011) A phylogenetic analysis of Stenostomum and its neotropical congeners, with a description of a new species from the Peruvian Amazon Basin. Invertebrate Systematics 25(2): 155–169. https://doi.org/10.1071/IS10026
  • Diez YL, Monnens M, Bosch C, Catalá J, Monnens M, Curini-Galletti M, Artois T (2023) Taxonomy and phylogeny of Dalytyphloplanida Willems et al., 2006 (Platyhelminthes: Rhabdocoela), with the description of a new family, a new genus, and sixteen new species from Cuba and Panama. Organisms, Diversity & Evolution 23: 631–681. https://doi.org/10.1007/s13127-023-00623-w
  • Diez YL, Sanjuan C, Bosch C, Catalá J, Monnens M, Curini-Galletti M, Artois T (2023) Diversity of free-living flatworms (Platyhelminthes) in Cuba. Biological Journal of the Linnean Society 140(3): 423–433. https://doi.org/10.1093/biolinnean/blad041
  • Diez YL, Sanjuan C, Reygel P, Roosen P, Artois T (2018) First record of Polycystididae (Platyhelminthes, Kalyptorhynchia) from Cuba, with the description of a new genus and five new species, and remarks and the description of one new species from Panama. Zootaxa 4514(1): 107–125. https://doi.org/10.11646/zootaxa.4514.1.9
  • Dols-Serrate D, Stocchino GA, Sluys R, Riutort M (2023) Fantastic beasts and how to delimit them: an integrative approach using multispecies coalescent methods reveals two new, endemic Dugesia species (Platyhelminthes: Tricladida) from Corsica and Sardinia. Zoological Journal of the Linnean Society 201(3): zlad135. https://doi.org/10.1093/zoolinnean/zlad135
  • Dumont HJ, Rietzler AC, Han BP (2014) A review of typhloplanid flatworm ecology, with emphasis on pelagic species. Inland Waters 4(3): 257–270. https://doi.org/10.5268/IW-4.3.558
  • Düren R, Ax P (1993) Thalassogene Plathelminthen aus Sandstränden von Elbe und Weser. Microfauna Marina 8: 267–280.
  • Felicia BA (2018) On the freshwater tricladid flatworms (Platyhelminthes, Tricladida) in the urban areas of Craiova (Romania) - Preliminary Data. Analele Universitatii din Craiova Biologie Horticultura Tehnologia Prelucrarii Produselor Agricole Ingineria Mediului 23: 275–285.
  • Gieysztor M (1931) Contribution a la connaissance des Turbellariés Rhabdocèles (Turbellaria Rhabdocoela) d‘Espagne. Bulletin de l’Academie Polonaise des Sciences et des Lettres 3(2): 125–153.
  • Glasgow B (2021) Some land planarians and freshwater turbellarians (Platyhelminthes) from Mississippi, USA. Journal of the Mississippi Academy of Sciences 66(3): 188–198. https://doi.org/10.31753/SPQQ6001_188
  • Graff L v (1882) Monographie der Turbellarien. I. Rhabdocoelida. Verlag von Wilhelm Engelmann, Leipzig, 441 pp.
  • Grimm AO (1877) Zur Kenntnis der Fauna des Ostsee. Arbeiten St. Petersburg Gesellschaft der Naturforscher 8: 1–32.
  • Guindon S, Dufayard J-F, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Systematic Biology 59(3): 307–321. https://doi.org/10.1093/sysbio/syq010
  • Hansen-Melander E, Melander Y, Reynoldsen TB (1954) A new species of freshwater triclad belonging to the genus Polycelis. Nature 173: 354–355. https://doi.org/10.1038/173354b0
  • Harrath AH, Sluys R, Merzoug D, Yacoubi-Khebiza M, Alwasel S, Riutort M (2012) Freshwater planarians (Platyhelminthes, Tricladida) from the Palearctic section of the African continent: new records, with the description of a new species. Zootaxa 3182(1): 1–15. https://doi.org/10.11646/zootaxa.3182.1.1
  • Higley R (1918) Morphology and biology of some Turbellaria from the Mississsippi basin. Zoological Laboratory of the University of Illinois: Illinois Biological Monographs 4: 1–95. https://doi.org/10.5962/bhl.title.16785
  • Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2017) UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35(2): 518–522. https://doi.org/10.1093/molbev/msx281
  • Hofsten N v (1911) Neue Beobachtungen über die Rhabdocolen und Allöocoelen der Schweiz. Zoologiska Bidrag fran Uppsala 1: 1–84.
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285
  • Katoh K, Rozewicki J, Yamada KD (2017) MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Briefings Bioinformatics 20(4): 1160–1166. https://doi.org/10.1093/bib/bbx108
  • Katoh K, Standley DM (2013) MAFFT Multiple Sequence Alignment Software Version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • Kenk R (1949) The animal life of temporary and permanent ponds in southern Michigan. Miscellaneous Publications, Museum of Zoology, University of Michigan 71: 1–66.
  • Kolasa J (1971) Two new species of Microturbellaria of the genera Stenostomum O. Schmidt and Macrostomum O. Schmidt. Bulletin de l’Academie Polonaise des Science - Serie des Sciences Biologiques 19(11): 743–747.
  • Kolasa J, Strayer D, Bannon-O’Donnell E (1987) Microturbellarians from interstitial waters, streams, and springs in southeastern New York. Journal of the North American Benthological Society 6(2): 125–132. https://doi.org/10.2307/1467222
  • Kolasa J, Tyler S (2010) Flatworms: turbellarians and nemertea. In: Thorp JH, Covich AP (Eds) Ecology and classification of North American freshwater invertebrates. Academic Press, London, 143–161. https://doi.org/10.1016/B978-0-12-374855-3.00006-6
  • Korgina EM (1999) Turbellaria fauna in reservoirs of the north-Dvina system. Zoological Journal 78(10): 1245–1247.
  • Lanfear R, Calcott B, Ho SYW, Guindon S (2012) Partition Finder: Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution 29: 1695–1701. https://doi.org/10.1093/molbev/mss020
  • Larsson K, Ahmadzadeh A, Jondelius U (2008) DNA taxonomy of Swedish Catenulida (Platyhelminthes) and a phylogenetic framework of catenulid classification. Organisms, Diversity & Evolution 8: 399–412. https://doi.org/10.1016/j.ode.2008.09.003
  • Liu HY, Dörler D, Heigl F, Grossberndt S (2021) Citizen science platforms. In: Vohland K, Land-Zandstra A, Ceccaroni L, Lemmens R, Perelló J, Ponti M, Samson R, Wagenknecht K (Eds) The science of citizen science. Springer, Switzerland, 439–459. https://doi.org/10.1007/978-3-030-58278-4_22
  • Luther A (1955) Die Dalyelliiden (Turbellaria, Neorhabdocoela). Eine Monographie. Acta Zoologica Fennica 87: 1–337.
  • Luther A (1960) Die Turbellarien Ostfennoskandiens 1. Acoela, Catenulida, Macrostomida, Lechithoepitheliata, Prolecithophora und Proseriata. Fauna Fennica 7: 1–154.
  • Luther A (1961) Die Turbellarien Ostfennoskandiens 2. Tricladida. Fauna Fennica 11: 1–42.
  • Mack-Fira V (1974) The turbellarian fauna of the Romanian littoral waters of the Black Sea and its annexes. In: Riser NW, Morse MP (Eds) Biology of Turbellaria. McGraw-Hill, New York, 248–290.
  • Majdi N, Araujo TQ, Bekkouche N, Fontaneto D, Garrigue J, Larrieu L, Kamburska L, Kieneke A, Minowa AK, Laumer C, Sabatino R, Sorel D, Stec D, Traunspurger W (2024) Freshwater and limno-terrestrial meiofauna of the Massane Forest Reserve in the Eastern French Pyrenees. Biogeographia - The Journal of Integrative Biogeography 39(1): a032. https://doi.org/10.21426/B639162226
  • Marcus E (1944) Sobre duas prorhynchidae (Turbellaria), novas para o Brasil. Arquivos do Museu Paranaense 4(1): 1–46.
  • Marcus E (1955) Turbellaria. Exploration du Parc National de la Garamba, Mission H. de Saeger (1949–1952) 3: 1–31.
  • Marcus E (1960) Turbellaria from Curaçao. Studies on the fauna of Curaçao and other Carribean Islands 44: 41–51.
  • Meixner J (1915) Zur Turbellarienfauna der Ost-Alpen, insonderheit des Lunzer Seengebietes. Arbeiten aus dem Zoologischen Institut zu Graz 10(3): 460–588.
  • Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Proceedings of the Gateway Computing Environments Workshop, 1–8. https://doi.org/10.1109/GCE.2010.5676129
  • Müller D, Faubel A (1993) The ‘Turbellaria’ of the River Elbe Estuary. A faunistic analysis of oligohaline and limnic areas. Archiv für Hydrobiologie Suppl. 75: 363–396.
  • Nasonov N (1919) Contributions a la faune des Turbellaria de la Russie. II–III. Bulletin de l’Academie des Sciences de l’URSS 13(16–18): 1039–1053.
  • Nasonov N (1926) Die Turbellarienfauna des Leningrader Gouvernements. Bulletin de l’Academie des Sciences de l’URSS 20(9): 817–836.
  • Ngamniyom A, Panyarachun B (2016) Stenostomum cf. leucops (Platyhelminthes) in Thailand: a surface observation using scanning electron microscopy and phylogenetic analysis based on 18S ribosomal DNA sequences. Songklanakarin Journal of Science and Technology 38(1): 41–45.
  • Nguyen L-T, Schmidt HA, von Haeseler A, Minh B (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Noreña C, Damborenea C, Brusa F (2005) A taxonomic revision of South American species of the genus Stenostomum O. Schmidt (Platyhelminthes: Catenulida) based on morphological characters. Zoological Journal of the Linnean Society 144: 37–58. https://doi.org/10.1111/j.1096-3642.2005.00157.x
  • Noreña C, Damborenea C, Faubel A, Brusa F (2007) Composition of meiobenthonic Platyhelminthes from brackish environments of the Galician and Cantabrian coasts of Spain with the description of a new species of Djeziraia (Polycystididae, Kalyptorhynchia). Journal of Natural History 41: 29–32. https://doi.org/10.1080/00222930701526055
  • Noreña-Janssen C (1995) Studies on the taxonomy and ecology of the Turbellaria (Platyhelminthes) in the floodplain of the Parana River (Argentina) II. Taxonomy and ecology of the Turbellaria. Archiv für Hydrobiologie 107(2): 212–262.
  • Nuttycombe JW, Waters AJ (1938) The American species of the genus Stenostomum. Proceedings of the American Philosophical Society 79(2): 213–298.
  • Okugawa KI (1953) A monograph of Turbellaria (Acoela, Rhabdocoela, Alloeocoela and Tricladida) of Japan and its adjacent regions. Kyoto Gakugei University, Series B, 3: 20–43.
  • Papi F (1951) Ricerche sui Turbellari Macrostomidae. Archivio Zoologico Italiano 36: 289–340.
  • Peng S, Liu XM, Wang AT, Qiu HL (2007) A newly recorded order of turbellarians with a newly recorded species from China (Lecithoepitheliata, Prorhynchidae). Acta Zootaxonomica Sinica 32(2): 433–437.
  • Pinchuk VI (1979) A planarian species Tricladida Paludicola from the Dnieper River Delta Ukrainian-SSR New for the Fauna of the USSR. Vestnik Zoologii 6: 86.
  • Reyes J, Binow D, Vianna RT, Brusa F, Martins SE (2021) Free-living microturbellarians (Platyhelminthes) from wetlands in Southern Brazil, with the description of three new species. Zoological Studies 60: 22. https://doi.org/10.6620%2FZS.2021.60-22
  • Richter A, Hauck J, Feldmann R, Kühn E, Harpke A, Hirneisen N, Mahla A, Settele J, Bonn A (2018) The social fabric of citizen science—drivers for long-term engagement in the German butterfly monitoring scheme. Journal of Insect Conservation 22: 731–743. https://doi.org/10.1007/s10841-018-0097-1
  • Riemann F (1965) Turbellaria Proseriata mariner Herkunft aus Sanden der Flußsohle im limnischen Bereich der Elbe. Zoologischer Anzeiger 174: 299–312.
  • Riemann F (1966) Die interstitielle Fauna im Elbe-Aestuar. Verbreitung und Systematik. Archiv für Hydrobiologie Supp. 31: 1–279.
  • Rixen J-U (1961) Kleinturbellarien aus dem Litoral der Binnengewässer Schleswig-Holsteins. Archive für Hydrobiologie 57(4): 464–538.
  • Ronneberger D (1975) Zur Kenntnis der Grundwasserfauna des Saale-Einzugsgebietes (Thüringen). Limnologica 9(3): 323–419.
  • Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2 efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Rosa MT, Pereira C, Ragagnin G, Loreto E (2015) Stenostomum leucops Duges, 1828 (Platyhelminthes, Catenulida): A putative species complex with phenotypic plasticity. Papéis Avulsos de Zoologia 55: 375–383. https://doi.org/10.1590/0031-1049.2015.55.27
  • Ruebush TK, Hayes WJ (1939) The genus Dalyellia in America II. A new form from Tennessee and a discussion of the relationships within the genus. Zoologischer Anzeiger 128: 136–152.
  • Schockaert ER (1996) Turbellarians. In: Hall GS (Ed.) Methods for the Examination of Organismal Diversity in Soils and Sediments. CAB International, Wallingford, 211–225.
  • Schockaert ER, Hooge M, Sluys R, Schilling S, Tyler S, Artois T (2008) Global diversity of free living flatworms (Platyhelminthes,“Turbellaria”) in freshwater. Hidrobiologia 595: 41–48. https://doi.org/10.1007/978-1-4020-8259-7_5
  • Schultze MS (1851) Beitrage zur Naturgeschichte der Turbellarien. C. A. Koch’s Verlagsjandlung, Greifswald, 78 pp.
  • Schwank P (1979) Two new Krumbachia (Turbellaria Neorhabdocoela) from highland streams near Schlitz, Hesse. Internationale Revue der gesamten Hydrobiologie und Hydrographie 64: 801–810. https://doi.org/10.1002/iroh.19790640608
  • Schwank P (1981) Turbellarien, Oligochaeten und Archianneliden des Breitenbachs und anderer oberhessischer Mittelgebirgsbäche - 1. Lokalgeographische Verbreitung und die Verteilung der Arten in den einzelnen Gewässern in Abhängigkeit vom Substrat (Schlitzer produktionsbiologische Studien (43-1)). Archiv für Hydrobiologie 1(Suppl. 62): 1–85.
  • Smith DG (1991) On some larger turbellarian worms (Platyhelminthes) living in temporary fresh waters of Southern New England. Hydrobiologia 220: 255–265. https://doi.org/10.1007/BF00006581
  • Southern R (1936) Turbellaria of Ireland. Proceedings of the Royal Irish Academy 43, 43–72.
  • Steinböck O (1923) Eine neue Gruppe allöocöler Turbellarien: Alloeocoela Typhlocoela (Familie Prorhynchidae). Zoologischer Anzeiger 58: 233–242.
  • Steinböck O (1931) Freshwater Turbellaria. In: Jensen S, Lundbeck W, Mortensen Th (Eds) Zoology of the Faroes. Copenhagen, 1–32.
  • Steinböck O (1932) Die Turbellarien des arktischen Gebietes. Fauna Arctica 297–342.
  • Steinböck O (1933) Die Turbellarienfauna der Umgebung von Rovigno. Thalassia 1(5): 1–32.
  • Steinböck O (1948) Freshwater Turbellaria. The Zoology of Iceland 2(10): 1–40.
  • Tessens B, Monnens M, Backeljau T, Jordaens K, Van Steenkiste N, Breman FC, Smeets K, Artois T (2021) Is ‘everything everywhere’? Unprecedented cryptic diversity in the cosmopolitan flatworm Gyratrix hermaphroditus. Zoologica Scripta 50(6): 837–851. https://doi.org/10.1111/zsc.12507
  • Timoshkin OA, Rozhkova NA, Zaytseva EP (2010) Diversity and ecology of free-living ciliated worms (Plathelminthes, Turbellaria) of Angara River and its catchment area with description of new species and new distribution localities of Kalyptorhynchia (Fam. Polycystididae and Rhynchokarlingiidae). In: Timoshkin OA (Ed) Index of animal species inhabiting Lake Baikal and its catchment area. Vol. II Book 1. 1125–1139.
  • Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ (2016) W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44: W232–W235. https://doi.org/10.1093/nar/gkw256
  • Tyler S, Varjabedian A, Hamami E (2018) Functional morphology of the venom apparatus of Prorhynchus stagnalis (Platyhelminthes, Lecithoepitheliata). Zoomorphology 137: 19–29. https://doi.org/10.1007/s00435-017-0382-7
  • Van Steenkiste N, Rivlin N, Kahn P, Wakeman K, Leander BS (2021) Grappleria corona gen. et sp. nov. (Platyhelminthes: Rhabdocoela: Jenseniidae fam. nov.) and an updated molecular phylogeny of ‘dalyelliid’ and temnocephalid microturbellarians. Systematics and Biodiversity 19(3): 261–272. https://doi.org/10.1080/14772000.2020.1841326
  • Van Steenkiste N, Tessens B, Krznaric K, Artois T (2011) Dalytyphloplanida (Platyhelminthes: Rhabdocoela) from Andalusia, Spain, with the description of four new species. Zootaxa 2791(1): 1–29. https://doi.org/10.11646/zootaxa.2791.1.1
  • Yamazaki M, Asakawa S, Murase J, Kimura M (2012) Phylogenetic diversity of microturbellarians in Japanese rice paddy fields, with special attention to the genus Stenostomum. Soil Science and Plant Nutrition 58(1): 11–23. https://doi.org/10.1080/00380768.2012.658350
  • Young JO (1970) Britisch and Irish freshwater Microturbellaria: historical records, new records and a key for their identification. Archive für Hydrobiologie 67(2): 210–241.
  • Young JO (1972) The Turbellaria of some Friesland lakes with incidental records of Gasteropoda [sic] and Hirudinea. Zoologische Bijdragen 13: 59–70.
  • Young JO (1973) The occurrence of Microturbellaria in some British lakes of diverse chemical content. Archive für Hydrobiologie 72(2): 202–224.
  • Young JO (1976) The freshwater Turbellaria of the African Continent. Zoologischer Anzeiger 197(5–6): 419–432.
  • Young JO, Kolasa J (1974) Studies on the genus Stenostomum O Schmidt (Turbellaria; Catenulida). IV. New records of established species from E. Africa, with notes on their anatomy and distribution. Freshwater Biology 4: 167–176. https://doi.org/10.1111/j.1365-2427.1974.tb00087.x
  • Young JO, Young BM (1976) First records of eight species and new records of four species of freshwater Microturbellaria from East Africa, with comments on modes of dispersal of the group. Zoologischer Anzeiger 196(1/2): 93–108.
login to comment