New Echiniscidae (Heterotardigrada) from Amber Mountain (Northern Madagascar)

Piotr Gąsiorek; Katarzyna Vončina

doi:10.3897/evolsyst.3.33580

Abstract

A moss sample from the local biodiversity hotspot in lowland rainforest in the vicinity of Amber Mountain, Madagascar, yielded the discovery of two Echiniscus C.A.S. Schultze, 1840 species, of which one is new to science. Echiniscus succineus sp. nov. is related to other members of the spinulosus group, but differs from them by the highly complicated structure of the dorsal plates, with intricately thickened parts of the armour forming ornamented pattern. The validity of the intraporal dark rings as a taxonomic trait is discussed in the context of the recovered intraspecific variability for the new taxon. Besides, rare Echiniscus africanus Murray, 1907 is reported for the first time from the island.

Key Words

appendages cuticle, Echiniscus africanus, morphology pores, spinulosus group, taxonomy

Introduction

Madagascan fauna is widely recognised among biologists for its unprecedented level of endemism and notable species diversity (Myers et al. 2000; Goodman and Benstead 2003, 2005; Holt et al. 2013). However, such enormous biodiversity, like in the majority of the tropical regions of the globe, is in great danger due to massive extirpation of rainforests (Brown and Gurevitch 2004). As an immense fraction of the world’s biodiversity remains unexplored (Mora et al. 2011), especially within the taxonomic groups belonging to aquatic meiofauna and limno-terrestrial microfauna, degradation of so unique ecosystems threatens many organisms. Tardigrades are micrometazoans that can be found both in sea and land habitats (Nelson et al. 2015), constituting an important portion of local species abundance. Madagascan tardigrades received almost no attention, with single papers which included two new echiniscid descriptions (Maucci 1993, Pilato and Lisi 2003). As a consequence, only 13 species were recorded from Madagascar. In the present contribution, we present the results of systematic study on two Echiniscus C.A.S. Schultze, 1840 species found in the Diana Region located in the Northern Madagascar. Echiniscus succineus sp. nov. is described by the means of morphological and genetic analyses and is included within the spinulosus group as it exhibits evident pores on all dorsal plates and appendages in the form of spines. Echiniscus africanus Murray, 1907, previously reported from South Africa, Angola, Tanzania, and Lesotho (da Cunha and do Nascimento Ribeiro 1964, Binda and Pilato 1995, Middleton 2003, Gąsiorek and Kristensen 2018), is also recorded and illustrated.

Materials and methods

Sample processing and microscopy

Twenty-two specimens of the new species and a single juvenile of E. africanus were extracted from one moss sample, collected from a tree at the edge of lowland rainforest in the vicinity of Amber Mountain (see the subsection Material examined for precise location) in December 2018. Dry material was placed and maintained in distilled water for 12 hours, approximately two weeks after collection. Tardigrade extraction procedure followed Stec et al. (2015). Hoyer’s medium was chosen for mounting the animals on permanent slides. Fifteen representatives of the new species and the individual of E. africanus were examined and photographed under a Nikon Eclipse 50i phase contrast microscope (PCM) associated with a Nikon Digital Sight DS-L2 digital camera. Three specimens of the new species were processed for scanning electron microscopy (SEM) according to the protocol by Stec et al. (2015). All figures were assembled in Corel Photo-Paint X8 software. For deep structures that could not be fully focused in a single photograph, a series of 5–8 images were taken every ca. 0.2 μm and then assembled into a single deep-focus image.

Morphometrics and terminology

All measurements are given in micrometres (μm) and were taken under PCM with Nikon Digital Sight DS-L2 software. Structures were measured only if their orientations were suitable, and structures were not twisted or broken. Body length was measured from the anterior to the posterior end of the body, excluding the hind legs. The sc ratio is the ratio of the length of a given structure to the length of the scapular plate (Fontoura and Morais 2011; values italicised in the tables). Morphometric data were handled using the Echiniscoidea ver. 1.2 template available from Tardigrada Register, www.tardigrada.net/register (Michalczyk and Kaczmarek 2013). Detailed measurements are additionally provided as Suppl. material 1. General taxonomy and morphological terminology follow Kristensen (1987), with the further amendments introduced by Gąsiorek et al. (2017, 2019).

Genetic data

DNA was extracted from four individuals of the new species (all animals were examined under 400× magnification in PCM prior to DNA extraction) following a Chelex® 100 resin (Bio-Rad) extraction method by Casquet et al. (2012) with modifications described in detail by Stec et al. (2015). Four molecular markers were sequenced (18S rRNA, 28S rRNA, ITS-2 and cox1); see Table 1 for primers and their source details. All fragments were amplified and sequenced according to the protocols described in Stec et al. (2015). Available 18S rRNA and 28S rRNA (dataset identical as in Gąsiorek et al. 2019) + ITS-2 and cox1 Echiniscus sequences were uploaded from GenBank to be aligned using default settings of MAFFT version 7 (Katoh et al. 2002; Katoh and Toh 2008). Uncorrected pairwise distances for trimmed alignments (898 bp – 18S rRNA, 670 bp – 28S rRNA, 427 bp – ITS-2, 535 bp – cox1) were calculated using MEGA7 (Kumar et al. 2016) and are presented in the Suppl. material 2.

Table 1.

Download as

CSV

XLSX

Primers used for sequencing of DNA fragments (one mitochondrial and four nuclear) of Echiniscus succineus sp. nov.

DNA fragment	Primer name	Primer direction	Primer sequence (5’-3’)	Primer source	PCR programme*
18S rRNA	18S_Tar_1Ff	forward	AGGCGAAACCGCGAATGGCTC	Stec et al. (2017)	Zeller (2010)
18S rRNA	18S_Tar_1Rr	reverse	GCCGCAGGCTCCACTCCTGG	Stec et al. (2017)	Zeller (2010)
28S rRNA	28S_Eutar_F	forward	ACCCGCTGAACTTAAGCATAT	Gąsiorek et al. (2018)	Mironov et al. (2012)
28S rRNA	28SR0990	reverse	CCTTGGTCCGTGTTTCAAGAC	Mironov et al. (2012)	Mironov et al. (2012)
ITS-2	ITS3	forward	GCATCGATGAAGAACGCAGC	White et al. (1990)	Wełnicz et al. (2011)
ITS-2	ITS4	reverse	TCCTCCGCTTATTGATATGC	White et al. (1990)	Wełnicz et al. (2011)
*cox1*	bcdF01	forward	CATTTTCHACTAAYCATAARGATATTGG	Dabert et al. (2008)	Wełnicz et al. (2011)
*cox1*	bcdR04	reverse	TATAAACYTCDGGATGNCCAAAAAA	Dabert et al. (2008)	Wełnicz et al. (2011)

Results

Taxonomic account

Phylum: Tardigrada Doyère, 1840

Class: Heterotardigrada Marcus, 1927

Order: Echiniscoidea Richters, 1926

Family: Echiniscidae Thulin, 1928

Genus: Echiniscus C.A.S. Schultze, 1840

Echiniscus africanus Murray, 1907

Fig. 1

Material examined

One juvenile individual. Terra typica: South Africa.

Synthetic description

Body yellow and plump, 140 μm long. Cephalic appendages lengths: cirrus internus 12.7, cephalic papilla (secondary clava) 5.8, cirrus externus 14.7, primary clava 4.1, cirrus A 30.3. Trunk appendage formula C-C^d-D-D^d-D^cd-E, most spines of similar lengths (16.1–19.0), but spines C^d and D^cd much shorter (7.5–9.4), and two additional spicules (2.5–3.1) present at the posterior edge of the scapular plate (29.6). The dorsal plate sculpture of the mixed type (sensu Gąsiorek et al. 2019), with large pores surrounded by polygonal edges on the scapular and caudal plates, and endocuticular pillars visible as densely arranged dark dots on the remaining plates, sometimes covered by thick epicuticular ornamentation (Fig. 1).

Figure 1.

Juvenile of Echiniscus africanus Murray, 1907 (PCM). Scale bar: in μm.

Leg appendages and claw lengths: spine on the first leg pair 2.6, papilla on the fourth leg pair 3.9, claws I–IV 7.5–9.3. Serrated fringe on the fourth leg pair consisting of nine teeth.

Distribution

This elusive species has been reported several times only from Southern and Eastern Africa since its description over a century ago (McInnes et al. 2017, Gąsiorek and Kristensen 2018). The record from Vietnam (Węglarska 1962) suggests either disjunctive range or misidentification with E. semifoveolatus Ito, 1993, which, however, is not properly delimited from the former species (Qiao et al. 2013).

Remarks

The specimen lacks lateral spines B and centrodorsal (mediodorsal) spines C^cd, which are characteristic for this species (Murray 1907, 1913). However, both positions are highly instable in terms of the presence/absence of appendages, which was demonstrated for E. lapponicus Thulin, 1911 with similar appendage configuration (Dastych 1980).

Echiniscus succineus sp. nov.

http://zoobank.org/D0F1B3CA-D1E6-49C3-8E2F-77973244E9E6

Figs 2, 3, 4, 5, Tables 2, 3

Material examined

Holotype (adult female on the slide MG.005.05) and sixteen paratypes (slides MG.005.04–7, including two voucher exoskeletons preserved after DNA extraction on the slides MG.005.28–29 and two specimens on the SEM stub no. 17.11). Except for two paratypes (slide MG.005.04) deposited in the Natural History Museum of Denmark, University of Copenhagen, the entire type series deposited in the Institute of Zoology and Biomedical Research, Jagiellonian University, Poland.

Locus typicus

Lowland rainforest close to the road from Joffreville (Diana Region, Antsiranana Province, Northern Madgascar); coordinates and altitude: 12°30'49"S, 49°10'56"E; 993 m asl. Substratum: moss growing on a tree branch (ca. two metres above ground level); collection: December 2018 by W. Witaliński.

Diagnosis

Small representative of the Echiniscus spinulosus group with peculiarly complex dorsal plate sculpturing developed as thick epicuticular ridges on scapular, paired segmental and caudal plates. Spines in almost all lateral and dorsal trunk positions. Parthenogenetic.

Description

Adult females and juveniles. Body dark yellow and plump. Red eyes present, dissolved after mounting. External cirri not markedly longer than internal cirri, with swollen cirrophores (Fig. 3C). Primary and secondary clavae (cephalic papillae) of similar lengths. Cirrus A short (cirrus A/body length ratio below 20%), with short and poorly marked cirrophore. Trunk appendage configuration (B)-C-C^d-D-D^d-E in adults (Figs 2, 3A–B), reduced to (C^d)-D^d-E in juveniles. All appendages in form of spines of similar lengths, spines D^d and E more robust, and sometimes gently serrated or rough (Figs 3A–B). Asymmetry in the development of appendages frequent, one of the spines B almost always absent, more rarely one of the spines C and D absent. Dorsal plates with rather irregularly distributed, large to very large pores (spinulosus type; Figs 2, 3). Dark endocuticular rings variously developed: from barely visible on the central portions of median plates (Fig. 3A) to well-developed rings present in pores from different plates (Figs 3B, 4A); they are the elements of sponge-like endocuticular layer visible under SEM (Fig. 3D, 4B). The level of development of the rings is not associated with life stage, and some individuals do not exhibit intraporal rings. Cephalic plate large, halved, with scarce and minute pores (Figs 2, 3A–C). Cervical (neck) plate present, poreless and developed as grey rectangular belt adjacent to the anterior margin of the scapular plate (Fig. 3A–C). Scapular plate with the system of thick epicuticular extensions, dividing its surface into clearly defined areas of thinner cuticle, being lighter under PCM and slightly concave under SEM (Fig. 3A–C). Median plates I–III large and uniformly dark under PCM, the first and the third plate are unipartite, whereas the second one is bipartite, with its anterior portion being a poorly developed, narrow triangle (Figs 2, 3A–B). At the posterior margins of median plates I–II and paired plates, irregular epicuticular thickenings may be present, especially in larger animals (compare Figs 3A–B, D). Each of paired plates indistinctly divided by a thin smooth band into a narrow anterior portion with condensed epicuticular matrix, and a larger posterior portion with more complex ornamentation pattern. The proximal part of each posterior portion is thick similarly to the anterior portion, but more distal one is thinner, with reduced and less numerous pores (Figs 3A–B, D). Marginally, a single dark epicuticular belt is present, and the second belt appears more centrally (Fig. 3A), however, sometimes it is not discernible (Fig. 3B). Caudal (terminal) plate with typical incisions, rarely sclerotised as if being a prolonged extensions of spine E (Fig. 3B). Its epicuticular ornamentation is similar in form to that occurring on the scapular plate (Figs 2, 3A), but may be less developed (Fig. 3B, 3E).

Figure 2.

Habitus of adult females of Echiniscus succineus sp. nov.: A – holotype, dorsal view (PCM); B – paratype, dorsal view (SEM); C – paratype, lateral view (PCM, insert with the claws of the second leg pair, black arrowhead indicates spur); D – paratype, lateral view (SEM). White arrowheads point out spine on the first leg. Scale bars: in μm.

Figure 3.

Detailed sculpturing of the dorsal plates of Echiniscus succineus sp. nov.: A – paratype, dorsal view (PCM, arrowheads indicate epicuticular thickenings); B – paratype, smaller specimen, dorsal view (PCM); C – scapular plate (SEM); D – portion of the second paired segmental plate (SEM); E – caudal plate (SEM). Roman numerals signify lateral ornamented belts. Scale bars: in μm.

Ventral plates absent, but simple granulation covers the entire venter from the subcephalic to genital zone. Endocuticular pillars minute and not-differentiated in size. Pedal plates and pulvini absent. Spine on the first leg pair minuscule (Figs 2A, 2C–D, 5A), either in the form of usual triangle or blunt (Fig. 2A). Dentate collar on the fourth leg pair present, with short teeth similar in shape (Figs 2, 3B). Papilla on the fourth leg pair present (Figs 2, 3B). External claws spurless, but internal ones bear acute spurs inserted at ca. 20–25% of the claw branch and directed downwards (Figs 2C, 5). Claws IV longer than claws I–III.

Figure 4.

Endocuticular (intraporal) rings of Echiniscus succineus sp. nov.: A– median plates I and II (PCM); B – central portion of the second paired segmental plate (SEM). Scale bars: in μm.

Figure 5.

Claws of Echiniscus succineus sp. nov. (SEM): A – first leg pair (small spine I visible in the upper right corner); B – fourth leg pair. Scale bars: in μm.

Larvae and eggs. Unknown.

DNA barcodes

Four genetic markers were represented by single haplotypes. The 18S rRNA sequence (898 bp long, GenBank accession no. MK675903):

GATAACTGTGGTAATTCTAGAGCTAATACATGCAGTAAGCCTTGACCTTTACCGGCAAGGCGCAGTTATTAGATCAAAA ACCAATCGGTTGTGTCTTCGGATGCAGCCGTTAGCTTGGTGACTCTGAGTAACCACAGCGAACCGTATGGCCTCGTGCTC GACGGTCTGTCAGTCAAGCAACTGCCTTATCAGCTTGTTGTTAGGTTATATGCCTAACAAGGCTTCAACGGGTAACGAAC GATCGGGGTCGGATATCGGAGAGGGAGCTTGAGAAACGGCTACCACTTCCAAGGAAGGCAGCAGGCGCGCAAATTACCCA CTCTCGGCATGAGGAGGTAGCGATAAAATGTATCGATGCGGGGCCATTAGTGCCTTCGTAATCGGAATGAGTACACTTTA AATCCTATAACAAGGACCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAA TGCTGCTGCGGTTAAAAAGCTCGTAGTCGGATCTGGGTTACCGGCGGGTACCGCATGTTGCTTCACGCAGCATGTTGTGT ACTATACGTGTCGCTTCGGCGGCACTGCCAGTGTAATTGTGCCTCACGTAGGTACGTTACGCTGGTCGCCGGAACCACGA GCCGGGTTGAGCAGCATGCTCTTAATTGAGTGTGTTGTTTACTCGGTGCGTTTACTTTGAAAAAATTGGAGTGCTCAAAG CAAGCGTACAGTCGCTATGCGGCTTGAACAGTGGTGCATGGAATAATGGAATAGGGCCTCGGTTCTATTTTGTTGGTTTT AAGATATCGAGGTAATGATTAAGAGGGACAGACGGGGACGTTTGTATTGCGACGTTAGAGGTGAAATTCTTGGATCGTCG CAAGACACACTAATGCGAA

The 28S rRNA sequence (767 bp long, GenBank accession no. MK675914):

GCTGGACTTAAGCATATTAATAAGCGGAGGAAAAGAAACCAACAGGGATATTCTCAGTAACGGCGAGTGAAGAGAATAcA GCCCAGCGCTGAATCATACTGCTTGCAAGAGTAGTACGACATGTAGCGTGAAACTGGCGGCTGTTGATGTTGTCGATGCGT GTAAGTCTTCTTGATTGAGGCTCAGTCCCAGAGATGGTGCTAGGCCCGTATCGCGCGTGACAAGTACAGCAACGCCCGCTT GTGGAGAGTCAGGTTGTTTGGGAACACAATCTAAAGCCGGTGGTACACTCCATCGAAGGCTAAATATGGCCACGAGTCCGA TAGCGAACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAATAGTGCGTGAAACCGCTTAGAGGCAA GCAGATGGATTCTCGAAGGTGTGCATAGGATTTATTTCCTAGTTCTCACGCCACCGCTGTTGTTGACGTGCACCATACGCT GACATTTGGACGCTTGAGATTGGGACTCGTGCCTGCTTGAGCTGCTCGGTGTCGGACGTATTGAGTTGATTCGTGGCATGC GATAACAGAGCAGAGCATTTGTCGTCGCTGTAAAGCGCTGACTGTGGCCGCTTGCTGATGCATTGTTGTTGTGGCAAGGCG CAAGCTTTGACATGCGATATGTATTGCAACTCGGCTATTAGTACCGGCAAGACGACTTCAAGACTCGGTGGCGAGTAGACG AACTTCCATCTAACCCGTCTTGAAACACGGACCAAGGGA

The ITS-2 sequence (442 bp long, GenBank accession no. MK675925):

GGTTTTCTGAACGTTAATTCTTCTAACGCAAATTGCAGCTGTGATTTTAGTCGCAGCTACGCCCGGTTGAGGGTCAGTTG ATCATAAACTCGCTTGTAACTGTTGTAACTACAAGCGCATTGGCTGTTCACATTGACTGCTTCAATGCGGCTGATGTGTTA GCTCAAATTGCCAAGCTGCCAACAAAGCAGTTTCGGATTTCTTGTTATGTATGCTGCTCTAGCAGGTCGTTGTTTGTCAGT ACTATGCACTGCTTCAAGATTATTGTGCGTGCTGACAAAGCTGCGTATGTGTGCGGCAGACAGCATGCGGACCAGTCGTTC GCATGACTCGTCTCTAACGGCATTTGCTTCTCATACACATATAACAAACCAATCATTTTTGTGACCTCAACTCGGACGAGA CTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA

The cox1 sequence (614 bp long, GenBank accession no. MK649675):

TACTTTATATTTTTATTTTTTGGTTTATGGGCTGCTTCTGTTGGTTCAAGTTTAAGGTTTTTAATTCGAACTGAATTATC TCAACCAGGAATTTGGTTAGGCGACGAGCATTTATATAATGTCTTAGTTACTTCCCATGCTTTAATTATAATTTTTTTTAT GGTAATACCAATCTTAATTGGTGGTTTTGGTAATTGATTAATTCCTATTATAATTGGTGCCCCGGATATGTCATTTCCTCG AATAAATAATTTAAGTTTTTGGCTTTTACTACCTTCTTTGCTTTTGCTATTGATTTCTTCTAATATTAGATCTGGTGTGGG CTCTGGTTGAACTTTATACCCACCTTTATCTGAATTTATTGGTCATTCTAATTATACTGTTGATATGGCTATTTTTTCTTT CCATGTTGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACTATTTTGAATATACGTTTTTTTTCTTTAAA TATAGAACAGTTATCTTTATTTGTTTGATCTGTTTTGATTACTGCTATCTTACTAATTTTATCTTTACCTGTTTTAGCCGG CGGTATTACTATATTATTGTTAGATCGTAATTTTAATAGTTCTTTTTT

Etymology

From Latin succineus = amber, referring to the locus typicus near Amber Mountain. An adjective in the nominative singular.

Comparative discussion: This is the second known member of the spinulosus group with scapular, paired segmental and caudal (terminal) plates markedly ornamented. Similar system of epicuticular thickenings exists in E. ornamentatus Gąsiorek & Kristensen, 2018 described recently from Tanzania, but an adult specimen of E. succineus sp. nov. is easily distinguishable from the latter taxon based on: the appendage configuration (A-(B)-C-C^d-D-D^d-E in E. succineus sp. nov. vs A-(B)-C-D-D^d-E in E. ornamentatus), the location of epicuticular ornamentation on the dorsal armour (except for the median plates, all trunk plates ornamented in E. succineus sp. nov. vs only scapular and caudal plates ornamented in E. ornamentatus), and the pore morphology (very large pores, sometimes with endocuticular dark rings in E. succineus sp. nov. vs minute pores, always without endocuticular dark rings in E. ornamentatus). The claws II–IV and all claw spurs seem to be relatively longer in E. succineus sp. nov. with respect to E. ornamentatus (compare values from Table 2 with table 4 from Gąsiorek and Kristensen (2018)), but given the low number of collated individuals, these traits are not included in the differential comparison.

Table 2.

Download as

CSV

XLSX

Measurements [in µm] of selected morphological structures of adult females (the 3^rd and older instars) of Echiniscus succineus sp. nov. mounted in Hoyer’s medium. N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation.

Character	N	Range						Mean		SD		Holotype
Character	N	µm			sc			µm	sc	µm	sc	µm	sc
Body length	12	156	–	221	457	–	586	196	535	18	39	204	533
Scapular plate length	12	32.1	–	38.9		–		36.6	–	2.1	–	38.3	–
Head appendages lengths
Cirrus internus	12	9.0	–	16.2	26.4	–	45.5	12.9	35.2	1.9	4.6	13.8	36.0
Cephalic papilla	12	5.8	–	8.1	17.3	–	22.8	7.0	19.1	0.6	1.6	7.7	20.1
Cirrus externus	12	12.4	–	18.7	34.6	–	52.5	15.2	41.5	1.9	4.7	17.7	46.2
Clava	12	4.5	–	7.6	13.2	–	21.3	6.1	16.7	0.8	2.0	6.6	17.2
Cirrus A	12	17.8	–	32.7	48.6	–	88.2	23.6	64.5	4.6	12.3	21.4	55.9
Cirrus A/Body length ratio	12	8%	–	18%		–		12%	–	3%	–	10%	–
Body appendages lengths
Spine B	8	6.9	–	11.6	18.1	–	32.3	10.3	27.6	1.6	4.7	10.7	27.9
Spine C	12	8.7	–	16.2	25.5	–	42.4	13.3	36.1	2.3	5.1	16.1	42.0
Spine C^d	12	5.3	–	15.7	15.5	–	44.1	12.0	32.6	2.8	6.9	13.8	36.0
Spine D	11	10.6	–	14.9	28.1	–	40.8	12.8	34.5	1.6	4.5	14.2	37.1
Spine D^d	12	14.3	–	21.7	37.4	–	63.6	16.9	46.5	2.0	7.1	16.4	42.8
Spine E	12	11.4	–	16.8	29.3	–	48.9	14.1	38.6	1.7	5.8	14.3	37.3
Spine on leg I length	12	1.7	–	2.9	4.8	–	7.7	2.2	6.1	0.3	0.9	2.1	5.5
Papilla on leg IV length	12	3.2	–	4.8	9.2	–	13.5	3.9	10.7	0.5	1.2	4.1	10.7
Number of teeth on the collar	11	8	–	12		–		9.8	–	1.1	–	10	–
Claw 1 lengths
Branch	12	8.5	–	10.7	22.1	–	28.2	9.6	26.1	0.7	1.7	10.7	27.9
Spur	5	1.5	–	2.3	4.2	–	6.7	1.8	5.2	0.3	1.0	2.0	5.2
Spur/branch length ratio	5	16%	–	24%		–		19%	–	3%	–	19%	–
Claw 2 lengths
Branch	12	8.0	–	10.1	23.7	–	27.6	9.3	25.5	0.6	1.3	10.1	26.4
Spur	6	1.5	–	2.3	4.2	–	5.9	1.8	5.0	0.3	0.7	1.9	5.0
Spur/branch length ratio	6	16%	–	23%		–		19%	–	2%	–	19%	–
Claw 3 lengths
Branch	12	8.1	–	10.5	23.3	–	27.4	9.3	25.4	0.7	1.4	10.5	27.4
Spur	8	1.5	–	2.0	4.1	–	5.2	1.7	4.7	0.2	0.4	2.0	5.2
Spur/branch length ratio	8	16%	–	21%		–		18%	–	2%	–	19%	–
Claw 4 lengths
Branch	11	10.1	–	12.9	27.5	–	33.7	11.4	31.0	0.9	1.8	12.9	33.7
Spur	4	1.8	–	2.4	5.1	–	7.0	2.1	5.9	0.3	0.9	?	?
Spur/branch length ratio	4	17%	–	22%		–		19%	–	2%	–	?	–

Table 3.

Download as

CSV

XLSX

Measurements [in µm] of selected morphological structures of juveniles (the 2^nd instar) of Echiniscus succineus sp. nov. mounted in Hoyer’s medium. N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation.

Character	N	Range						Mean		SD
Character	N	µm			sc			µm	sc	µm	sc
Body length	3	128	–	160	508	–	533	141	518	17	13
Scapular plate length	3	25.2	–	30.0		–		27.1	–	2.6	–
Head appendages lengths
Cirrus internus	3	6.0	–	12.6	23.8	–	42.0	8.6	31.1	3.5	9.6
Cephalic papilla	3	4.0	–	5.6	15.9	–	18.7	4.7	17.1	0.8	1.4
Cirrus externus	3	8.5	–	14.7	33.7	–	49.0	10.9	39.7	3.3	8.2
Clava	3	3.8	–	5.7	14.6	–	19.0	4.5	16.3	1.1	2.3
Cirrus A	3	13.9	–	23.5	55.2	–	78.3	17.4	63.5	5.3	12.9
Cirrus A/Body length ratio	3	11%	–	15%		–		12%	–	2%	–
Body appendages lengths
Spine C^d	1	9.8	–	9.8	32.7	–	32.7	9.8	32.7	?	?
Spine D^d	3	11.6	–	18.0	46.0	–	60.0	14.4	52.8	3.3	7.0
Spine E	3	6.7	–	13.1	26.6	–	48.7	10.8	39.6	3.6	11.6
Spine on leg I length	2	1.2	–	2.4	4.8	–	8.0	1.8	6.4	0.8	2.3
Papilla on leg IV length	3	1.9	–	3.3	7.5	–	11.0	2.7	9.8	0.7	1.9
Number of teeth on the collar	3	7	–	8		–		7.7	–	0.6	–
Claw 1 lengths
Branch	3	6.0	–	8.0	23.8	–	26.7	6.8	25.1	1.0	1.4
Spur	0		?			?		?	?	?	?
Spur/branch length ratio	0		?			–		?	–	?	–
Claw 2 lengths
Branch	3	5.6	–	8.0	22.2	–	26.8	6.9	25.2	1.2	2.6
Spur	2	0.6	–	0.7	2.4	–	2.7	0.7	2.5	0.1	0.2
Spur/branch length ratio	2	10%	–	11%		–		10%	–	1%	–
Claw 3 lengths
Branch	3	5.8	–	8.4	23.0	–	28.0	6.8	25.1	1.4	2.6
Spur	2	0.9	–	1.3	3.6	–	4.3	1.1	4.0	0.3	0.5
Spur/branch length ratio	2	15%	–	16%		–		15%	–	0%	–
Claw 4 lengths
Branch	3	6.9	–	9.7	26.4	–	32.3	7.8	28.7	1.6	3.2
Spur	0		?			?		?	?	?	?
Spur/branch length ratio	0		?			–		?	–	?	–

Three other species are similar to E. succineus sp. nov. in overall morphology: E. marginatus Binda & Pilato, 1994, E. scabrospinosus Fontoura, 1982 and E. tropicalis Binda & Pilato, 1995. E. succineus sp. nov. differs from:

E. marginatus, reported from Hawaii Archipelago, by the appendage configuration (A-(B)-C-C^d-D-D^d-E in E. succineus sp. nov. vs A-(C)-(D)-D^d-E in E. marginatus), and the morphology of posterior portions of median plates I–II (narrow and with irregular thickenings in E. succineus sp. nov. vs broad, solid and poreless in E. marginatus, see Pilato et al. 2008);

E. scabrospinosus, known from Western Palaearctic and Afrotropical realm, by the appendage configuration (A-(B)-C-C^d-D-D^d-E in E. succineus sp. nov. vs A-(C)-(D)-D^d-E in E. scabrospinosus), and the morphology of posterior portions of median plates I–II (with irregular thickenings in E. succineus sp. nov. vs porous in E. scabrospinosus, see Pilato et al. 2008);

E. tropicalis, recorded from the Seychelles, by the appendage morphology (spines in E. succineus sp. nov. vs very short, triangular spicules in E. tropicalis), and spurs on the internal claws IV (identical to spurs on internal claws I–III in E. succineus sp. nov. vs larger and better developed spurs IV, more divergent from the claw branches than on internal claws I–III in E. tropicalis).

Comparative genetic analysis: The uncorrected pairwise distances between E. succineus sp. nov. and the remaining Echiniscus spp. were as follows: (1) 18S rRNA – from 0.5% (E. manuelae da Cunha & do Nascimento Ribeiro, 1962) to 2.5% (E. testudo (Doyère, 1840)); (2) 28S rRNA – from 2.7% (E. manuelae) to 6.1% (E. testudo); (3) ITS-2 – from 17.6% (E. testudo) to 22.9% (E. blumi Richters, 1903); (4) cox1 – from 15.7% (E. merokensis Richters, 1904) to 18.5% (E. granulatus (Doyère, 1840)).

Discussion

The knowledge on the Madagascan tardigrade fauna is limited. Most of the taxa recorded by Maucci (1993) are now recognised as species complexes, thus the presence of type species being typical Palearctic elements on Madagascar is highly dubious (e.g. Guidetti et al. 2019, Morek et al. 2019). In result of the paucity of studies, its microfauna is of unknown origin at present (Yoder and Nowak 2006). E. africanus inhabits unchanged lowland rainforest on the island, which suggests some influence of Afrotropical fauna on Madagascan biota. Interestingly, species most similar in terms of morphology to E. succineus sp. nov. also occur in the tropical and subtropical zone.

Traditional species delineation in many Echiniscidae relied on the appendage configuration, however the spinulosus group poses a significant problem in this context as characterised by high variability in symmetry and presence of trunk spines. Pilato et al. (2008) introduced the presence of intraporal rings as a specific trait and an additional criterion in the taxonomy of the spinulosus group. Nevertheless, the variability in the development of these structures, shown for the first time to be endocuticular elements of the sponge-like layer, in E. succineus sp. nov., suggests the need for re-assessment of the validity of this feature. Considering the fact of explicitly emphasised significance of the dorsal plate sculpturing for classification and understanding the phylogeny of the Echiniscus lineage (Gąsiorek et al. 2019), the clarification of this issue would be desirable. There is a possibility that some species within the spinulosus complex always exhibit or do not exhibit dark rings, whereas other taxa are more inconstant in that respect.

Acknowledgements

I express my gratitude to two colleagues: Professor Wojciech Witaliński (Jagiellonian University), who kindly collected the moss sample, and Daniel Stec, who extracted the animals from substratum. Two reviewers are acknowledged for help in improving this work.

References

Binda MG, Pilato G (1994) Notizie sui Tardigradi delle Isole Hawaii con descrizione di due specie nuove. Animalia 21(1/3): 57–62.

Binda MG, Pilato G (1995) Remarks on the tardigrades from the Seychelles, with a description of two new species. Tropical Zoology 8: 1–6. https://doi.org/10.1080/03946975.1995.10539269

Binda MG, Pilato G (1995) Some notes on African tardigrades with description of two new species. Tropical Zoology 8: 367–372. https://doi.org/10.1080/03946975.1995.10539294

Brown KA, Gurevitch J (2004) Long-term impacts of logging on forest diversity in Madagascar. PNAS 101(16): 6045–6049. https://doi.org/10.1073/pnas.0401456101

Casquet J, Thebaud C, Gillespie RG (2012) Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Molecular Ecology Resources 12: 136–141. https://doi.org/10.1111/j.1755-0998.2011.03073.x

Dabert J, Ehrnsberger R, Dabert M (2008) Glaucalges tytonis sp. nov. (Analgoidea: Xolalgidae) from the barn owl Tyto alba (Strigiformes: Tytonidae): compiling morphology with DNA barcode data for taxa descriptions in mites (Acari). Zootaxa 1719: 41–52.

da Cunha AX, do Nascimento Ribeiro F (1962) A fauna de tardígrados da Ilha da Madeira. Memórias e estudos do Museu zoológico da Universidade de Coimbra 279: 1–24.

da Cunha AX, do Nascimento Ribeiro F (1964) Tardígrados de Angola, Garcia de Orta (Lisboa) 12(3): 397–406.

Dastych H (1980) Niesporczaki (Tardigrada) Tatrzańskiego Parku Narodowego. Monografie Fauny Polski 9: 1–232.

Doyère LMF (1840) Mémoire sur les Tardigrades. Annales des Sciences Naturelles Paris, Series 2 14: 269–362.

Fontoura P (1982) Deux nouvelles espèces de Tardigrades muscicoles du Portugal. Publicações do Instituto de Zoologia ‘Dr Augusto Nobre’, Faculdade de Ciências do Porto 165: 5–19.

Fontoura P, Morais P (2011) Assessment of traditional and geometric morphometrics for discriminating cryptic species of the Pseudechiniscus suillus complex (Tardigrada, Echiniscidae). Journal of Zoological Systematics and Evolutionary Research 49 (s1): 26–33. https://doi.org/10.1111/j.1439-0469.2010.00594.x

Gąsiorek P, Kristensen RM (2018) Echiniscidae (Heterotardigrada) of Tanzania and Uganda. Tropical Zoology 31(3): 131–160. https://doi.org/10.1080/03946975.2018.1477350

Gąsiorek P, Morek W, Stec D, Michalczyk Ł (2019) Untangling the Echiniscus Gordian knot: paraphyly of the “arctomys group” (Heterotardigrada: Echiniscidae). Cladistics. https://doi.org/10.1111/cla.12377

Gąsiorek P, Stec D, Morek W, Michalczyk Ł (2017) An integrative redescription of Echiniscus testudo (Doyère, 1840), the nominal taxon for the class Heterotardigrada (Ecdysozoa: Panarthropoda: Tardigrada). Zoologischer Anzeiger 270: 107–122. https://doi.org/10.1016/j.jcz.2017.09.006

Gąsiorek P, Stec D, Zawierucha K, Kristensen RM, Michalczyk Ł (2018) Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa 4472(2): 261–297. https://doi.org/10.11646/zootaxa.4472.2.3.

Goodman SM, Benstead JP (2003) The Natural History of Madagascar. The University of Chicago Press, Chicago, USA, 1709 pp.

Goodman SM, Benstead JP (2005) Updated estimates of biotic diversity and endemism for Madagascar. Oryx 39(1): 73–77. https://doi.org/10.1017/S0030605305000128

Guidetti R, Cesari M, Bertolani R, Altiero T, Rebecchi L (2019) High diversity in species, reproductive modes and distribution within the Paramacrobiotus richtersi complex (Eutardigrada, Macrobiotidae). Zoological Letters 5: 1. https://doi.org/10.1186/s40851-018-0113-z

Holt BG, Lessard J-P, Borregaard MK, Fritz SA, Araújo MB, Dimitrov D, Fabre P-H, Graham CH, Graves GR, Jønsson KA, Nogués-Bravo D, Wang Z, Whittaker RJ, Fjeldså J, Rahbek C (2013) An update of Wallace’s zoogeographic regions of the world. Science 339(6115): 74–78. https://doi.org/10.1126/science.1228282

Ito M (1993) Taxonomic study on the class Heterotardigrada (Tardigrada) from the northern slope of Mt. Fuji, Central Japan. Edaphologia 50: 1–13.

Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30(14): 3059–3066. https://doi.org/10.1093/nar/gkf436

Katoh K, Toh H (2008) Recent developments in the MAFFT multiple sequence alignment program. Briefings in Bioinformatics 9(4): 286–298. https://doi.org/10.1093/bib/bbn013

Kristensen RM (1987) Generic revision of the Echiniscidae (Heterotardigrada), with a discussion of the origin of the family. Biology of Tardigrades. Selected Symposia and Monographs U.Z.I., 1, 261–335.

Kumar S, Stecher G, Tamura K (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870–1874. https://doi.org/10.1093/molbev/msw054

Marcus E (1927) Zur Anatomie und Ökologie mariner Tardigraden. Zoologische Jahrbücher. Abteilung für Anatomie und Ontogenie der Tiere 53: 487–558.

Maucci W (1993) Prime notizie su Tardigradi ‘terrestri’ del Madagascar con descrizione di tre specie nuove. Bollettino del Museo Civico di Storia Naturale di Verona 17: 381–392.

McInnes SJ, Michalczyk Ł, Kaczmarek Ł (2017) Annotated zoogeography of non-marine Tardigrada. Part IV: Africa. Zootaxa 4284(1): 1–74. https://doi.org/10.11646/zootaxa.4284.1.1

Michalczyk Ł, Kaczmarek Ł (2013) The Tardigrada Register: a comprehensive online data repository for tardigrade taxonomy. Journal of Limnology 72(s1): 175–181. https://doi.org/10.4081/jlimnol.2013.s1.e22

Middleton RC (2003) Tardigrades in southern Africa. African Journal of Ecology 41: 280–282. https://doi.org/10.1046/j.1365-2028.2003.00439.x

Mironov SV, Dabert J, Dabert M (2012) A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa 3253: 54–61. https://doi.org/10.11646/zootaxa.3253.1.2

Mora C, Tittensor DP, Adl S, Simpson AGB, Worm B (2011) How many species are there on Earth and in the Ocean? PLoS Biology 9(8): e1001127. https://doi.org/10.1371/journal.pbio.1001127

Morek W, Stec D, Gąsiorek P, Surmacz B, Michalczyk Ł (2019) Milnesium tardigradum Doyère, 1840: The first integrative study of interpopulation variability in a tardigrade species. Journal of Zoological Systematics and Evolutionary Research 57: 1–23. https://doi.org/10.1111/jzs.12233

Murray J (1907) XII. Some South African Tardigrada. Journal of the Royal Microscopical Society 12: 515–524. https://doi.org/10.1111/j.1365-2818.1907.tb01665.x

Murray J (1913) IV. African Tardigrada. Journal of the Royal Microscopical Society 33(2): 136–144. https://doi.org/10.1111/j.1365-2818.1913.tb01014.x

Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Kent J (2000) Biodiversity hotspots for conservation priorities. Nature 403: 853–858. https://doi.org/10.1038/35002501

Nelson DR, Guidetti R, Rebecchi L (2015) Chapter 17: Phylum Tardigrada. In: Thorp JH, Rogers DC (Eds) Thorp and Covich’s Freshwater Invertebrates, Academic Press, Cambridge, Massachusetts, 347–380. https://doi.org/10.1016/B978-0-12-385026-3.00017-6

Pilato G, Fontoura P, Lisi O, Beasley C (2008) New description of Echiniscus scabrospinosus Fontoura, 1982, and description of a new species of Echiniscus (Heterotardigrada) from China. Zootaxa 1856: 41–54.

Pilato G, Lisi O (2003) Echiniscus walteri, new species of tardigrade from Madagascar. Bollettino del Museo Civico di Storia Naturale di Verona 27: 65–70.

Qiao P, Zhang P, Sun X, Li X (2013) Echiniscus semifoveolatus (Heterotardigrada: Echiniscidae), a newly recorded species from China. Zootaxa 3718(2): 183–192. https://doi.org/10.11646/zootaxa.3718.2.6

Richters F (1903) Arktische Tardigraden. Fauna Arctica 3: 493–508.

Richters F (1904) Beitrag zur Verbreitungen der Tardigraden im südlichen Skandinavien und an der mecklenburgischen Küste. Zoologischer Anzeiger 28: 347–352.

Richters F (1926) Tardigrada. In: Kükenthal W (Ed.) Handbuch der Zoologie, de Gruyter, Berlin and Leipzig, III, 58–61.

Schultze CAS (1840) Echiniscus Bellermanni, Animal Crustaceum, Macrobiotus hufelandii affine. Berlin, Apud G. Reimer, 1–8.

Stec D, Smolak R, Kaczmarek Ł, Michalczyk Ł (2015) An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052(5): 501–526. https://doi.org/10.11646/zootaxa.4052.5.1

Stec D, Zawierucha K, Michalczyk Ł (2017) An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland. Zootaxa 4300(3): 403–420. https://doi.org/10.11646/zootaxa.4300.3.4

Thulin G (1911) Beiträge zur Kenntnis der Tardigradenfauna Schwedens. Arkiv för zoologi 7(16): 1–60. https://doi.org/10.5962/bhl.part.1270

Thulin G (1928) Über die Phylogenie und das System der Tardigraden. Hereditas 11: 207–266. https://doi.org/10.1111/j.1601-5223.1928.tb02488.x

Wełnicz W, Grohme MA, Kaczmarek Ł, Schill RO, Frohme M (2011) ITS-2 and 18S rRNA data from Macrobiotus polonicus and Milnesium tardigradum (Eutardigrada, Tardigrada). Journal of Zoological Systematics and Evolutionary Research 49(S1): 34–39. https://doi.org/10.1111/j.1439-0469.2010.00595.x

Węglarska B (1962) Die Tardigraden Vietnams. Vestnik Ceskoslovenské Spolecnosti Zoologické 26(4): 300–307.

White TJ, Bruns T, Lee S, Taylor J (1990) PCR protocols: a guide to methods and application. Academic Press, California, San Diego, 482 pp.

Yoder AD, Nowak MD (2006) Has vicariance or dispersal been the predominant biogeographic force in Madagascar? Only time will tell. Annual Review of Ecology, Evolution and Systematics 37: 405–431. https://doi.org/10.1146/annurev.ecolsys.37.091305.110239

Zeller C (2010) Untersuchung der Phylogenie von Tardigraden anhand der Genabschnitte 18S rDNA und Cytochrom c Oxidase Untereinheit 1 (COX I). MSc Thesis, Wildau, Germany: Technische Hochschule Wildau.

Supplementary materials

Supplementary material 1

Detailed tables with morphometry

Piotr Gąsiorek, Katarzyna Vončina

Data type: morphometric data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (130.66 kb)

Supplementary material 2

Uncorrected pairwise distances

Piotr Gąsiorek, Katarzyna Vončina

Data type: genetic data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (44.50 kb)