Research Article
Print
Research Article
Echiniscidae in the Mascarenes: the wonders of Mauritius
expand article infoYevgen Kiosya‡, Katarzyna Vončina§, Piotr Gąsiorek§
‡ V. N. Karazin Kharkiv National University, Kharkiv, Ukraine
§ Jagiellonian University, Kraków, Poland

Corresponding author: Piotr Gąsiorek ( piotr.lukas.gasiorek@gmail.com )

Academic editor: Andreas Schmidt-Rhaesa
© 2021 Yevgen Kiosya, Katarzyna Vončina, Piotr Gąsiorek.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Kiosya Y, Vončina K, Gąsiorek P (2021) Echiniscidae in the Mascarenes: the wonders of Mauritius. Evolutionary Systematics 5(1): 93-120. https://doi.org/10.3897/evolsyst.5.59997
ZooBank: urn:lsid:zoobank.org:pub:22050C34-40A5-4B7A-9969-222AE927D6AA
Open Access

Abstract

Many regions of the world remain unexplored in terms of the tardigrade diversity, and the islands of the Indian Ocean are no exception. In this work, we report four species of the family Echiniscidae representing three genera from Mauritius, the second largest island in the Mascarene Archipelago. Two species belong in the genus Echiniscus: Echiniscus perarmatus Murray, 1907, a pantropical species, and one new species: Echiniscus insularis sp. nov., one of the smallest members of the spinulosus group and the entire genus, being particularly interesting due to the presence of males and supernumerary teeth-like spicules along the margins of the dorsal plates. The new species most closely resembles Echiniscus tropicalis Binda & Pilato, 1995, for which we present extensive multipopulation data and greatly extend its distribution eastwards towards islands of Southeast Asia. Pseudechiniscus (Meridioniscus) mascarenensis sp. nov. is a typical member of the subgenus with elongated (dactyloid) cephalic papillae and the pseudosegmental plate IV’ with reduced posterior projections in males. Finally, a Bryodelphax specimen is also recorded. The assemblage of both presumably endemic and widely distributed tardigrade species in Mauritius fits the recent emerging biogeographic patterns for this group of micrometazoans.

Key Words

Biodiversity, distribution, Heterotardigrada, insular fauna, morphology, sculpturing

Introduction

Tardigrades, as many micrometazoan taxa, remain mostly ignored in biodiversity surveys, although molecular techniques indicate the presence of multiple lineages and high potential for cryptic speciation (Blaxter et al. 2003, Cesari et al. 2020). Recent estimates augment the increasing evidence for the existence of numerous species complexes (Faurby et al. 2012; Jørgensen et al. 2018; Guidetti et al. 2019; Morek and Michalczyk 2020), however, rather mediocre species richness of this phylum emerges when compared to other animal groups characterised by greater species abundance by an order of magnitude (Bartels et al. 2016). Many regions of the world have never been sampled in a search for tardigrades, although the collection of these animals is very easy and not costly (Degma 2018). Archipelagos in the Western Indian Ocean are known as centres of insular endemism and local biodiversity hotspots (Goodman and Benstead 2005; Cheke and Hume 2008), but the scarcity of faunistic tardigrade studies precludes a more in-depth look into the evolutionary history of the phylum in this area. Tardigrades were particularly intensively sampled in the Seychelles (Biserov 1994; Binda and Pilato 1995; Pilato et al. 2002, 2004, 2006, 2009a, 2009b) and Madagascar (see Gąsiorek and Vončina 2019; Kaczmarek et al. 2020 for summary). Single papers were devoted to either limno-terrestrial or marine tardigrades of Mauritius (Grimaldi De Zio et al. 1987), Maldives (De Zio Grimaldi et al. 1999), and Réunion (Séméria 2003). Other archipelagos, like the Comoros or Socotra, have not been explored for these animals. Among the smaller islands of the Western Indian Ocean, the fauna of Mauritius has received the greatest attention and appeals for conservation effort of the best-studied insects, especially beetles (Motala et al. 2007).

The purpose of this contribution is to provide the first integrative data for the Mauritian members of the armoured tardigrades from the family Echiniscidae (Heterotardigrada). They include detailed DNA barcoding and morphological information for two species new to science, extracted from two moss samples. The new species represent the genera Echiniscus and Pseudechiniscus, the most speciose echiniscid taxa. Novel morphological characters are depicted for the Echiniscus spinulosus complex based on the smallest and dioecious member of this inordinately species-rich, by tardigrade standards, group. We also elaborate on Echiniscus tropicalis, the cognate taxon of the new species. Finally, the records of species with wide tropical or even pantropical distribution support the supposition that very broad geographic ranges may be typical for tropical tardigrade taxa (Gąsiorek et al. 2019). This is in accordance with data for oribatid mites inhabiting the Madagascan region, a significant fraction of which comprises pantropical species (Niedbała 2017).

Materials and methods

Sample collection and processing

Tardigrades were extracted from two moss samples (MU.001–2) collected from Sophie Nature Walk in the vicinity of Mare aux Vacoas (ca. 20°22'S, 57°29'E, 580 m asl; Mauritius, Mascarene Archipelago, Western Indian Ocean; O. Garmish leg. on 7th September 2019). Samples were rehydrated in Petri dishes, and then processed according to standard protocols (Dastych 1980; Stec et al. 2015). The animals were used in three analyses: (I) qualitative and quantitative morphology investigated with phase contrast microscopy (PCM); (II) high-resolution imaging with scanning electron microscopy (SEM); (III) DNA sequencing. Additionally, populations of Echiniscus tropicalis were obtained and underwent an identical procedure (Table 1).

Table 1.
Download as
CSV
XLSX

List of the populations of Echiniscus tropicalis examined in this study. Types of analyses: (LCM) imaging and morphometry in PCM, (SEM) imaging in SEM, (DNA) DNA sequencing. Number in each analysis indicates how many specimens were utilised in a given method (a – adults, j – juveniles, l – larvae).

Sample code Coordinates altitude Locality Sample type Collector Analyses
LCM SEM DNA
ID.032 8°16'35"S, 115°29'29"E, 521 m asl Indonesia, Bali, Karangasem Regency moss from tree bark Łukasz Michalczyk 23a 20a 10a
ID.071 ca. 2°10'N, 97°26'E, 0–20 m asl Indonesia, coastline of Sumatra, Palambak Island moss from tree bark Łukasz Skoczylas 3a – –
ID.858 0°39'47"N, 127°24'11"E, 1717 m asl Indonesia, the Moluccas, Tidore, Gunung Kiematubu moss and lichen from rock Piotr Gąsiorek 2a – –
ID.939 1°15'53"N, 124°53'57"E, 696 m asl Indonesia, Celebes, Sulawesi Utara, shores of Danau Tondano moss and lichen from tree bark Piotr Gąsiorek and Łukasz Krzywański 363a + 16j + 10l 10a 10a
ID.951 1°10'02"N, 124°49'22"E, 743 m asl Indonesia, Celebes, Sulawesi Utara, Ramo Lewo moss and lichen from palm tree Piotr Gąsiorek and Łukasz Krzywański 1a – –
MY.008 5°58'54"N, 116°04'42"E, 30 m asl Malaysia, Borneo, Sabah, Kota Kinabalu, Bukit Bendera Street moss from concrete wall Piotr Gąsiorek 1a + 1j – –
SG.001 1°21'39"N, 103°53'24"E, 12 m asl Singapore moss from tree bark Tan Pal Chun 9a – –

Microscopy, imaging and morphometrics

Permanent microscope slides were made using Hoyer’s medium and examined under Olympus BX53 phase contrast microscope (PCM) equipped with a digital camera Olympus DP74. In order to obtain ideally dorso-ventrally or dorso-laterally positioned and flattened specimens, specimens were first completely air-dried, then mounted in a minuscule drop of medium which did not fill the entire space between the slide and cover slip, and, eventually, the missing portion of medium was added at the edges of the cover slip to refill the empty space after 30 minutes. Specimens were prepared for SEM according to the protocol by Stec et al. (2015). All figures were assembled in Corel Photo-Paint X7. All measurements are given in micrometres (μm) and were performed under PCM. Structures were measured only when not broken, deformed or twisted, and their orientations were suitable. Body length was measured from the anterior to the posterior end of the body, excluding the hind legs. The sp ratio, the ratio of the length of a given structure to the length of the scapular plate, was expressed as a percentage (Dastych 1999). Morphometric data were handled using the Echiniscoidea ver. 1.3 template available from the Tardigrada Register, www.tardigrada.net (Michalczyk and Kaczmarek 2013). Raw data are presented as Suppl. materials 1–5. Scientific drawing of the ventral sculpturing pattern of the new Pseudechiniscus species was made in Microsoft PowerPoint using microphotographs and direct observations of specimens in PCM.

Genotyping, genetic comparisons and phylogenetics

DNA was extracted from individual animals following the Chelex 100 resin (Bio-Rad) extraction method (Casquet et al. 2012; Stec et al. 2015). Each specimen was observed in a drop of distilled water on a temporary slide under a 400× magnification prior to investigation. Hologenophores (Pleijel et al. 2008) were obtained for E. insularis sp. nov., E. perarmatus and P. mascarenensis sp. nov. Five DNA fragments were sequenced: four nuclear and one mitochondrial in the case of E. insularis sp. nov., four for E. perarmatus (excluding ITS-2, all will be presented in another contribution) and three for P. mascarenensis sp. nov. (excluding ITS-2 and COI). Both ITS-2 and COI are highly variable markers and are often difficult to amplify, as in these cases. All fragments were amplified and sequenced according to the protocols described in Stec et al. (2015). Primers and PCR programmes are presented in Table 2.

Table 2.
Download as
CSV
XLSX

Primers and references for specific protocols for amplification of the four DNA fragments sequenced in the study.

DNA fragment Primer name Primer direction Primer sequence (5'-3') Primer source PCR programme*
18S rRNA 18S_Tar_Ff1 forward AGGCGAAACCGCGAATGGCTC Stec et al. (2017) Zeller (2010)
18S_Tar_Rr2 reverse CTGATCGCCTTCGAACCTCTAACTTTCG Gąsiorek et al. (2017)
28S rRNA 28S_Eutar_F forward ACCCGCTGAACTTAAGCATAT Gąsiorek et al. (2018) Mironov et al. (2012)
28SR0990 reverse CCTTGGTCCGTGTTTCAAGAC Mironov et al. (2012)
ITS-1 ITS1_Echi_F forward CCGTCGCTACTACCGATTGG Gąsiorek et al. (2019) Wełnicz et al. (2011)
ITS1_Echi_R reverse GTTCAGAAAACCCTGCAATTCACG
ITS-2 ITS-3 forward GCATCGATGAAGAACGCAGC White et al. (1990) Wełnicz et al. (2011)
ITS-4 reverse TCCTCCGCTTATTGATATGC
COI bcdF01 forward CATTTTCHACTAAYCATAARGATATTGG Dabert et al. (2008) Wełnicz et al. (2011)
bcdR04 reverse TATAAACYTCDGGATGNCCAAAAAA

* – All PCR programmes are also provided in Stec et al. (2015).

ITS-1 and ITS-2 sequences were used to reconstruct a concatenated Maximum Likelihood (ML) phylogeny for E. insularis sp. nov.; GenBank accession numbers for the sequences retrieved from GenBank are presented in the Suppl. material 6. Alignments were 741 bp (ITS-1) and 546 bp (ITS-2) long. SequenceMatrix was used for concatenation (Vaidya et al. 2011). ModelFinder (Kalyaanamoorthy et al. 2017) was used to choose the best-fit models: TIM3+F+G4 (ITS-1 partition) and TPM2+F+G4 (ITS-2 partition), chosen according to the Bayesian information criterion. W-IQ-TREE was used for ML reconstruction (Nguyen et al. 2015; Trifinopoulos et al. 2016). One thousand ultrafast bootstrap (UFBoot) replicates were applied to provide support values for branches (Hoang et al. 2018). Trees were rooted on Diploechiniscus oihonnae (Richters, 1903). The final consensus trees were visualised with FigTree ver. 1.4.3 (available at: http://tree.bio.ed.ac.uk/software/figtree/).

Results

Systematic account

Phylum: Tardigrada Doyère, 1840

Class: Heterotardigrada Marcus, 1927

Order: Echiniscoidea Richters, 1926

Family: Echiniscidae Thulin, 1928

Bryodelphax Thulin, 1928

Material

Single adult female on slide MU.001.01.

Remarks

A remarkably ornamented dorsum indicates that the individual found belongs to a new species. Its formal description is impossible with such scarce material.

Genus: Echiniscus C.A.S. Schultze, 1840

Echiniscus insularis sp. nov. Gąsiorek, Vončina & Kiosya

http://zoobank.org/1C027A99-2712-4825-A41A-3479E3768C3A
Figures 1, 2, 3, 4, 5, 6, 7, 8, Tables 3, 4, 5

Locus typicus and type material

ca. 20°22'S, 57°29'E, 580 m asl; Sophie Nature Walk, vicinity of Mare aux Vacoas (Plaines Wilhems, Mauritius, Mascarene Archipelago, Western Indian Ocean); mosses from tree trunks. Holotype (mature female on slide MU.002.04), allotype (mature male on slide MU.002.02), seven paratypic females, fourteen paratypic males, and five juveniles (slides MU.001.01–3, MU.002.01–6). One hologenophore on slide MU.001.24, and three hologenophores the slide MU.002.07. All deposited in the Department of Invertebrate Evolution.

Etymology

From Latin insula = island. The name refers to locus typicus. Adjective in the nominative singular.

Description

Mature females (i.e. from the third instar onwards; measurements in Table 3). Body small and plump (Figs 1, 3, 6A), yellow to orange, with minute red eyes absent after mounting. Ordinary primary and secondary (cephalic papillae) clavae of the Echiniscus-type; peribuccal cirri with well-developed cirrophores. Cirrus A very short (<25% of the body length), with cirrophore. Body appendage configuration A-(B)-C-Cd-D-Dd-E, with the majority of appendages developed as spicules, slightly longer spines can occur only in the positions Cd, Dd, and E (Figs 1, 3B, 6A). Asymmetries frequent, but only rarely are more appendages absent (Fig. 3A). Additionally, supernumerary spicules occur along the margins of all dorsal plates and sometimes on their surface (Fig. 6A), particularly frequent (up to five) along the caudal incisions (Fig. 6D, E). Spines and spicules are always smooth and simple, not ramified.

Table 3.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of mature females of Echiniscus insularis sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation).

Character N Range Mean SD Holotype
µm sp µm sp µm sp µm sp
Body length 7 122 – 169 466 – 591 150 514 16 41 136 529
Scapular plate length 7 25.7 – 35.4 – 29.1 – 3.2 – 25.7 –
Head appendages lengths
Cirrus internus 7 8.5 – 13.2 32.4 – 40.9 10.8 37.1 1.7 3.4 9.0 35.0
Cephalic papilla 7 5.0 – 7.0 16.9 – 22.2 5.9 20.3 0.6 1.8 5.7 22.2
Cirrus externus 7 10.9 – 15.9 40.7 – 52.2 13.5 46.3 1.6 4.2 12.9 50.2
Clava 7 3.6 – 5.5 11.9 – 17.5 4.4 15.2 0.6 1.9 4.5 17.5
Cirrus A 7 24.2 – 37.0 86.1 – 106.2 28.3 96.9 4.1 7.0 27.3 106.2
Cirrus A/Body length ratio 7 17% – 22% – 19% – 2% – 20% –
Body appendages lengths
Spine B 5 2.5 – 3.2 8.8 – 10.8 2.8 9.8 0.3 0.7 2.5 9.7
Spine C 7 2.0 – 5.2 7.6 – 20.2 4.0 14.1 1.3 5.0 5.2 20.2
Spine Cd 7 2.3 – 11.0 8.8 – 39.9 5.9 20.6 3.3 11.6 4.6 17.9
Spine D 6 2.5 – 4.0 7.6 – 15.6 3.1 10.5 0.6 3.1 4.0 15.6
Spine Dd 7 7.5 – 15.4 22.6 – 53.3 11.3 39.5 3.2 12.4 12.0 46.7
Spine E 5 2.2 – 9.6 7.5 – 32.7 6.5 23.0 2.7 9.5 6.0 23.3
Supernumerary spicules 24 0.7 – 4.6 2.4 – 17.9 – – – – – –
Spine on leg I length 7 1.6 – 2.6 5.8 – 7.5 2.0 6.7 0.4 0.7 1.6 6.2
Papilla on leg IV length 7 2.8 – 3.5 9.9 – 12.5 3.1 10.7 0.2 0.8 3.2 12.5
Number of teeth on the collar 7 7 – 11 – 8.6 – 1.6 – 11 –
Claw 1 heights
Branch 7 7.0 – 10.3 26.2 – 30.7 8.3 28.5 1.0 1.8 7.9 30.7
Spur 4 1.7 – 2.1 5.8 – 8.2 1.8 6.6 0.2 1.1 2.1 8.2
Spur/branch length ratio 4 20% – 27% – 23% – 3% – 27% –
Claw 2 heights
Branch 7 7.2 – 9.4 24.5 – 30.8 7.9 27.2 0.8 2.5 7.7 30.0
Spur 5 1.3 – 2.5 4.4 – 7.1 1.7 5.5 0.5 1.1 ? ?
Spur/branch length ratio 5 18% – 27% – 21% – 3% – ? –
Claw 3 heights
Branch 7 6.9 – 9.9 25.5 – 32.7 8.1 27.8 1.0 2.9 8.4 32.7
Spur 5 1.3 – 2.2 4.4 – 6.2 1.7 5.5 0.4 0.7 ? ?
Spur/branch length ratio 5 16% – 24% – 20% – 3% – ? –
Claw 4 heights
Branch 7 8.2 – 10.8 28.8 – 35.8 9.2 31.7 0.8 2.1 9.2 35.8
Spur 3 2.0 – 2.7 6.8 – 8.7 2.4 7.7 0.4 0.9 ? ?
Spur/branch length ratio 3 21% – 27% – 24% – 3% – ? –
Figure 1.

Habitus of females of Echiniscus insularis sp. nov. (PCM): A dorsal view (cA – cirrus A, ce – cirrus externus, ci – cirrus internus, cl – (primary) clava, cp – cephalic papilla), B dorsolateral view, C lateral view. Note irregularly distributed spicules along margins of the dorsal plates. Scale bars in μm.

Dorsal plates strongly sclerotised and well-demarcated from each other, with the spinulosus type sculpturing, i.e. only pores are present (Figs 1, 3, 6A). Pores are densely arranged and may be of various size: from medium (Figs 1B, C, 3B, 6A) to large (Fig. 1A), even merging into groups of two/three pores (Fig. 3A). Dark endocuticular rings usually absent (Figs 1, 3B, 6A), or present, but only in the largest pores (Fig. 3A). Only in one female are pores absent and irregular dark epicuticular swellings are developed, most visible on the scapular plate (Fig. 4A). The cephalic plate consists of two halves, with an anterior chalice-like incision (Figs 1A, 3A). The cervical (neck) plate is in the form of a narrow grey belt, weakly delineated anterior to the scapular plate (Figs 1A, 3). The scapular plate non-facetted, with the usual lateral sutures delineating small rectangular portions (Figs 1, 3). Three median plates: m1, m3 unipartite, the latter reduced to a narrow stripe, and m2 bipartite (Figs 3A, 6A); sculpture well-developed in all portions of the median plates with the exception of the anterior portion of m2, where it is reduced (Figs 1B, C, 3, 6A). Two pairs of large segmental plates, their narrower anterior portions with two thin belts devoid of sculpture (Figs 1B, 3, 6A) or with only one belt (Fig. 3B). The caudal (terminal) plate with evident incisions (Figs 1, 3) and may be facetted (Figs 3B, 6A).

Ventral cuticle smooth. Sexpartite gonopore located anteriorly of legs IV and a trilobed anus between legs IV. Pedal plates absent, but dim pulvini present (Figs 1B, 3A). Spine I thin and minute (Figs 1, 3A). Dentate collar IV composed of numerous acute teeth (Fig. 7D). Papilla on leg IV present (Figs 1, 3, 6A). Claws I–IV of similar heights. External claws on all legs smooth. Internal claws with proportionally large spurs positioned at ca. 1/4–1/3 of the claw height, spurs IV slightly heteromorphic since they are more divergent from the branches than spurs I–III (compare Fig. 7A–C, D).

Mature males (i.e. from the third instar onwards; measurements in Table 4). Body slender (Fig. 2). Only one male has rudimentary developed pores (Fig. 4B). Males have often comparatively better developed supernumerary spicules than females (Fig. 2B). Clavae enlarged, more prominent than in females (Figs 2, 6B). Subcephalic region with a pair of weakly developed oval swellings (probably rudimentary subcephalic plates). Gonopore circular, with a U-shaped slit; semicircular bulge resembling a genital plate with a cracked surface present anterior to the gonopore (Fig. 6C).

Table 4.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of mature males (one hologenophore included) of Echiniscus insularis sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation).

Character N Range Mean SD Allotype
µm sp µm sp µm sp µm sp
Body length 15 113 – 167 500 – 596 145 548 15 28 167 582
Scapular plate length 15 22.2 – 28.8 – 26.4 – 1.8 – 28.7 –
Head appendages lengths
Cirrus internus 14 5.6 – 13.8 23.0 – 49.6 10.0 37.5 2.2 7.1 9.4 32.8
Cephalic papilla 15 4.5 – 7.2 18.5 – 27.8 6.4 24.1 0.7 2.6 7.2 25.1
Cirrus externus 15 7.9 – 18.0 32.5 – 64.7 13.7 51.6 2.7 8.2 15.6 54.4
Clava 15 3.2 – 6.1 14.4 – 23.1 4.8 18.0 0.8 2.7 5.8 20.2
Cirrus A 15 17.2 – 29.9 77.5 – 112.7 24.1 90.9 3.6 9.5 29.9 104.2
Cirrus A/Body length ratio 15 15% – 20% – 17% – 1% – 18% –
Body appendages lengths
Spine B 6 1.6 – 2.9 6.0 – 11.1 2.4 8.7 0.5 1.8 ? ?
Spine C 15 2.2 – 5.0 8.3 – 17.4 3.7 13.9 0.7 2.4 5.0 17.4
Spine Cd 5 2.4 – 8.0 10.8 – 32.9 5.4 21.2 2.0 7.9 ? ?
Spine D 15 1.9 – 3.5 6.8 – 13.3 2.6 9.8 0.5 2.1 2.7 9.4
Spine Dd 14 3.2 – 13.2 13.1 – 49.2 10.1 38.3 2.7 9.7 11.4 39.7
Spine E 13 3.9 – 7.7 14.8 – 28.2 5.9 21.9 1.3 4.9 5.7 19.9
Supernumerary spicules 32 0.6 – 3.0 2.1 – 11.5 – – – – – –
Spine on leg I length 15 1.2 – 2.4 4.9 – 9.2 1.8 6.9 0.4 1.3 1.9 6.6
Papilla on leg IV length 15 2.3 – 4.0 9.5 – 13.9 3.1 11.8 0.4 1.4 4.0 13.9
Number of teeth on the collar 15 7 – 11 – 9.2 – 1.3 – 11 –
Claw 1 heights
Branch 13 5.7 – 9.7 23.5 – 34.2 8.3 31.2 1.2 2.9 9.7 33.8
Spur 9 1.5 – 2.3 6.2 – 8.7 1.8 6.9 0.2 0.8 2.1 7.3
Spur/branch length ratio 9 20% – 26% – 22% – 2% – 22% –
Claw 2 heights
Branch 14 5.7 – 9.2 23.5 – 33.1 7.8 29.5 1.1 2.7 8.8 30.7
Spur 10 1.3 – 2.4 5.2 – 9.4 1.7 6.5 0.3 1.3 1.6 5.6
Spur/branch length ratio 10 17% – 29% – 21% – 4% – 18% –
Claw 3 heights
Branch 15 5.0 – 9.3 20.6 – 33.7 7.9 29.9 1.2 3.1 9.1 31.7
Spur 7 1.2 – 2.0 4.9 – 7.8 1.7 6.5 0.3 0.9 ? ?
Spur/branch length ratio 7 17% – 25% – 22% – 2% – ? –
Claw 4 heights
Branch 15 6.4 – 11.2 26.3 – 42.4 9.4 35.4 1.4 4.2 11.2 39.0
Spur 8 1.5 – 2.6 6.2 – 10.2 2.3 8.7 0.4 1.2 ? ?
Spur/branch length ratio 8 22% – 28% – 25% – 2% – ? –
Figure 2.

Habitus of males of Echiniscus insularis sp. nov. (PCM): A dorsal view, B dorsolateral view, C lateral view. Note differences between the density of supernumerary spicules at margins of the dorsal plates. Scale bars in μm.

Figure 3.

Habitus of females of Echiniscus insularis sp. nov.: A specimen with appendages (arrowheads) greatly reduced in number and aberrantly large, merging pores (PCM, dorsolateral view), B typical female with ordinary set of appendages (SEM, dorsal view). Scale bars in μm.

Figure 4.

Habitus of Echiniscus insularis sp. nov. – individuals with aberrantly developed dorsal sculpturing (PCM): A female, dorsal view, B male, dorsolateral view. Note differences in the development of appendages. Scale bars in μm.

Juveniles (i.e. from the second instar onwards; measurements in Table 5). No morphometric gap between adults and juveniles (likely a result of general miniaturisation of the species). Qualitatively similar to adults (Fig. 5). Gonopore absent.

Table 5.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of juveniles of Echiniscus insularis sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation).

Character N Range Mean SD
µm sp µm sp µm sp
Body length 5 100 – 140 422 – 625 121 507 18 75
Scapular plate length 5 18.4 – 29.4 – 24.2 – 4.3 –
Head appendages lengths
Cirrus internus 5 5.3 – 9.5 22.4 – 34.7 7.4 30.6 1.6 5.1
Cephalic papilla 5 3.5 – 5.6 16.8 – 21.5 4.6 18.9 0.8 1.7
Cirrus externus 5 6.6 – 13.0 35.9 – 50.6 10.8 44.0 2.8 5.6
Clava 5 3.0 – 4.7 13.5 – 18.5 3.8 15.8 0.7 2.0
Cirrus A 5 15.3 – 27.3 83.2 – 101.3 22.4 92.0 5.2 8.3
Cirrus A/Body length ratio 5 13% – 24% – 19% – 4% –
Body appendages lengths
Spine B 1 2.2 – 2.2 9.3 – 9.3 2.2 9.3 ? ?
Spine C 5 2.2 – 4.2 12.0 – 18.9 3.7 15.4 0.9 2.9
Spine Cd 4 2.1 – 8.4 7.1 – 35.4 5.6 22.3 2.9 11.9
Spine D 5 1.3 – 3.7 7.1 – 15.6 2.7 11.0 0.9 3.3
Spine Dd 5 6.7 – 13.0 36.4 – 54.9 10.6 43.8 2.4 7.3
Spine E 4 4.1 – 7.3 22.1 – 30.8 5.8 24.9 1.5 4.1
Supernumerary spicules 18 1.1 – 3.0 5.0 – 12.7 – – – –
Spine on leg I length 4 1.1 – 2.6 5.0 – 8.8 1.8 7.1 0.8 2.0
Papilla on leg IV length 5 2.1 – 2.9 9.9 – 12.2 2.6 10.7 0.4 1.1
Number of teeth on the collar 5 6 – 10 – 7.8 – 1.5 –
Claw 1 heights
Branch 5 5.6 – 8.1 26.1 – 32.1 7.0 29.1 1.2 2.4
Spur 3 1.0 – 2.1 4.5 – 7.1 1.5 6.2 0.6 1.5
Spur/branch length ratio 3 17% – 26% – 22% – 5% –
Claw 2 heights
Branch 5 4.9 – 7.7 25.2 – 28.7 6.5 26.8 1.2 1.5
Spur 3 1.0 – 1.7 5.4 – 5.8 1.3 5.5 0.4 0.2
Spur/branch length ratio 3 20% – 23% – 22% – 1% –
Claw 3 heights
Branch 5 5.3 – 7.3 24.8 – 28.8 6.4 26.6 1.0 1.8
Spur 3 1.0 – 1.6 5.4 – 5.9 1.3 5.6 0.3 0.2
Spur/branch length ratio 3 19% – 24% – 21% – 2% –
Claw 4 heights
Branch 4 6.3 – 8.6 27.6 – 34.2 7.4 30.5 1.2 3.0
Spur 1 2.0 – 2.0 6.8 – 6.8 2.0 6.8 ? ?
Spur/branch length ratio 1 25% – 25% – 25% – ? –
Figure 5.

Habitus of juvenile of Echiniscus insularis sp. nov. with fully developed appendages (PCM, dorsolateral view). Scale bar in μm.

Larvae. Unknown.

Eggs. One egg per exuviae was found in few examined exuviae.

Figure 6.

Morphological details of Echiniscus insularis sp. nov.: A female in lateral view (SEM), B male cephalic appendages (SEM), C male gonopore (SEM), D, E appendages along the caudal incision (PCM). Scale bars in μm.

Figure 7.

Claws of Echiniscus insularis sp. nov.: A claws I (PCM, empty arrowhead indicates the asymmetric lack of internal spur), B claws II (SEM), C claws III (SEM), D claws IV with dentate collar (SEM). Scale bars in μm.

DNA sequences and phylogenetic position

Two haplotypes in all markers were found, corresponding with the populations MU.001 and MU.002: 18S rRNA (MW180887, MW180888), 28S rRNA (MW180879, MW180880), ITS-1 (MW180910, MW180911), ITS-2 (MW180898, MW180899), and in COI (MW178242, MW178243). p-distance in COI between the two populations is 4.9%. Echiniscus insularis sp. nov. belongs in the spinulosus complex, being a sister species to the clade composed of E. manuelae da Cunha & do Nascimento Ribeiro, 1962 + E. tristis Gąsiorek & Kristensen, 2018 (Fig. 8).

Figure 8.

Phylogenetic position of Echiniscus insularis sp. nov. on the Maximum Likelihood consensus phylogenetic tree; the E. spinulosus complex is marked in green and Diploechiniscus oihonnae was used as an outgroup. ML bootstrap values are presented above the branches.

Remarks

The species is easily recognisable because of the additional supernumerary dorsal spicules along margins of all plates and sometimes on the plates, making it an unusual member of the spinulosus group and of the entire genus. Besides, it is one of the smallest representatives of Echiniscus with the average adult body length at ca. 150 μm, whereas adults of Echiniscus spp. usually reach 200–250 μm at least. There is one species resembling specimens of E. insularis sp. nov. with a lower number of spicules – E. tropicalis Binda & Pilato, 1995 described from the Seychelles. For the purpose of the comparison E. insularis sp. nov. – E. tropicalis, we present updated description of the latter species below.

Due to the fact that E. manuelae and E. tristis currently emerge as species closest phylogenetically to E. insularis sp. nov., we compare them with the new species accordingly:

  • E. manuelae has larger and more sparsely distributed pores in dorsal plates (see fig. 3 in da Cunha & do Nascimento Ribeiro (1962) and fig. 5 in Gąsiorek and Kristensen (2018)), and appendages C d + D d are long and serrated (smooth and short in E. insularis sp. nov.);
  • E. tristis is a larger species (adult females ≥ 180 μm in E. tristis vs < 170 μm in E. insularis sp. nov.) and has larger claw spurs that are more divergent from branches than in E. insularis sp. nov.

Echiniscus tropicalis Binda & Pilato, 1995

Figures 8, 9, 10, 11, Tables 6, 7, 8

Material

Together 402 adult females, 17 juveniles and 10 larvae mounted on slides.

Description

Mature females (i.e. from the third instar onwards; measurements in Table 6). Body small and plump (Figs 9A, 11A), yellow to orange, with minute red eyes absent after mounting. Ordinary primary and secondary (cephalic papillae) clavae of the Echiniscus-type; peribuccal cirri with well-developed cirrophores. Cirrus A very short (<25% of the body length), with cirrophore. Body appendage configuration A-B-C-Cd-D-Dd-E, with all appendages developed as spines or spicules, which are smooth or only sometimes spines E are serrated (Figs 9A, 10, 11A). Asymmetries frequent, especially in the lateral positions.

Table 6.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of mature females of Echiniscus tropicalis (pooled data from the populations ID.032, ID.939 and SG.001) mounted in Hoyer’s medium (N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation).

Character N Range Mean SD
µm sp µm sp µm sp
Body length 26 137 – 223 384 – 513 194 476 20 31
Scapular plate length 26 33.6 – 45.2 – 40.9 – 3.3 –
Head appendages lengths
Cirrus internus 24 10.0 – 14.5 22.2 – 36.0 12.3 30.0 1.3 3.1
Cephalic papilla 26 5.0 – 7.7 12.6 – 18.8 6.1 14.9 0.5 1.5
Cirrus externus 25 11.2 – 18.2 27.5 – 41.7 14.8 36.4 1.9 3.2
Clava 25 4.2 – 6.4 9.3 – 16.3 5.0 12.2 0.6 1.6
Cirrus A 25 17.9 – 33.8 41.1 – 79.3 27.8 68.1 3.7 8.2
Cirrus A/Body length ratio 25 9% – 18% – 14% – 2% –
Body appendages lengths
Spine B 24 4.3 – 12.7 9.9 – 29.4 8.5 20.8 2.4 5.5
Spine C 26 6.5 – 14.7 14.9 – 35.0 11.1 27.1 2.3 5.1
Spine Cd 26 3.0 – 10.8 7.7 – 25.0 6.7 16.4 1.7 4.0
Spine D 22 5.7 – 13.8 13.5 – 31.3 10.0 24.3 2.4 5.3
Spine Dd 25 4.3 – 14.9 9.9 – 35.0 10.2 25.1 2.6 6.3
Spine E 26 7.1 – 15.8 16.3 – 38.0 12.1 29.6 2.3 5.5
Spine on leg I length 26 1.9 – 3.7 4.2 – 8.8 2.6 6.4 0.5 1.1
Papilla on leg IV length 25 2.8 – 4.3 6.7 – 10.9 3.4 8.3 0.3 1.0
Number of teeth on the collar 25 8 – 17 – 12.3 – 2.3 –
Claw 1 heights
Branch 25 9.6 – 12.4 24.7 – 30.4 10.9 26.8 0.8 1.5
Spur 23 1.5 – 2.6 4.0 – 6.0 2.0 4.9 0.3 0.5
Spur/branch length ratio 23 15% – 21% – 18% – 2% –
Claw 2 heights
Branch 26 9.2 – 12.0 22.9 – 28.6 10.4 25.6 0.8 1.5
Spur 25 1.6 – 2.7 3.9 – 6.2 1.9 4.7 0.3 0.5
Spur/branch length ratio 25 16% – 23% – 19% – 2% –
Claw 3 heights
Branch 25 8.7 – 12.3 23.2 – 28.6 10.4 25.6 0.8 1.5
Spur 23 1.5 – 2.7 3.8 – 6.2 1.9 4.7 0.3 0.6
Spur/branch length ratio 23 15% – 23% – 18% – 2% –
Claw 4 heights
Branch 26 10.7 – 14.8 25.9 – 34.9 12.6 30.8 1.1 1.9
Spur 18 2.0 – 3.1 5.3 – 7.1 2.4 6.0 0.2 0.5
Spur/branch length ratio 18 18% – 24% – 20% – 2% –
Figure 9.

Habitus of Echiniscus tropicalis in dorsolateral view (PCM): A adult female (black arrowheads indicate pulvini, whereas white arrowheads – pedal plates), B larva. Scale bars in μm.

Dorsal plates strongly sclerotised and well-demarcated from each other, with the spinulosus type sculpturing, i.e. only pores are present (Figs 9A, 10, 11). Pores are densely arranged and rather of uniform size. Dark endocuticular rings absent (Figs 10, 11B, C). The cephalic plate consists of two halves, with an anterior chalice-like incision. The cervical (neck) plate is in the form of a narrow grey belt, weakly delineated anterior to the scapular plate (Fig. 10). The scapular plate non-facetted, with the usual lateral sutures delineating small rectangular portions (Figs 9A, 10). Three median plates: m1, m3 unipartite, the latter reduced to a narrow stripe; m2 bipartite (Figs 9A, 10, 11). Two pairs of large segmental plates, their narrower anterior portions with two thin belts devoid of sculpture (Fig. 10). The caudal (terminal) plate with evident incisions (Figs 9A, 10) and may be facetted (Fig. 11A).

Figure 10.

Dorsal plate sculpturing of Echiniscus tropicalis in close-up (PCM). Scale bar in μm.

Ventral cuticle smooth or with densely arranged endocuticular pillars. Sexpartite gonopore located anteriorly of legs IV and a trilobed anus between legs IV. Pedal plates and pulvini present (Fig. 9A). Spine I thin and minute (Fig. 9A). Dentate collar IV composed of numerous acute teeth (Figs 9A, 11A). Papilla on leg IV present (Fig. 9A). Claws IV slightly higher than claws I–III. External claws on all legs smooth. Internal claws with heteromorphic spurs positioned at ca. 1/4–1/3 of the claw height.

Figure 11.

Dorsal plate sculpturing of Echiniscus tropicalis (SEM): A adult female in dorsal view, B, C pores in close-up. Scale bars in μm.

Mature males. Absent.

Juveniles (i.e. from the second instar onwards; measurements in Table 7). No morphometric gap or qualitative differences between adult and juvenile females found. Gonopore absent.

Table 7.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of juveniles of Echiniscus tropicalis (population ID.939) mounted in Hoyer’s medium (N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation).

Character N Range Mean SD
µm sp µm sp µm sp
Body length 10 143 – 169 444 – 506 158 475 9 19
Scapular plate length 10 29.9 – 35.4 – 33.2 – 1.8 –
Head appendages lengths
Cirrus internus 9 7.6 – 9.6 22.4 – 29.0 8.7 25.8 0.8 2.2
Cephalic papilla 9 4.6 – 5.5 13.3 – 17.5 5.1 15.5 0.3 1.2
Cirrus externus 10 10.2 – 13.7 34.1 – 41.8 12.1 36.4 0.9 2.3
Clava 10 3.6 – 4.5 11.2 – 12.9 4.0 12.2 0.3 0.6
Cirrus A 9 22.2 – 25.6 63.3 – 78.0 23.4 71.1 1.3 5.3
Cirrus A/Body length ratio 9 13% – 16% – 15% – 1% –
Body appendages lengths
Spine B 9 3.5 – 7.4 10.4 – 22.8 5.3 15.7 1.5 4.4
Spine C 10 6.5 – 10.5 19.9 – 33.4 8.7 26.3 1.5 4.4
Spine Cd 10 4.6 – 7.9 14.1 – 24.4 6.5 19.6 1.0 2.9
Spine D 7 2.1 – 8.8 6.4 – 26.1 5.3 15.9 2.5 7.8
Spine Dd 10 10.1 – 14.3 28.9 – 42.2 11.4 34.2 1.3 3.8
Spine E 10 7.8 – 13.0 23.9 – 40.1 11.2 33.8 1.5 4.3
Spine on leg I length 10 1.8 – 2.6 5.3 – 7.9 2.1 6.2 0.2 0.8
Papilla on leg IV length 10 2.4 – 3.0 6.8 – 9.0 2.7 8.2 0.2 0.6
Number of teeth on the collar 10 7 – 12 – 10.3 – 1.7 –
Claw 1 heights
Branch 10 7.3 – 9.3 23.4 – 27.8 8.7 26.2 0.6 1.4
Spur 9 1.3 – 1.7 3.7 – 5.4 1.6 4.8 0.1 0.5
Spur/branch length ratio 9 16% – 22% – 18% – 2% –
Claw 2 heights
Branch 10 7.2 – 8.6 22.0 – 26.5 8.0 24.1 0.5 1.4
Spur 7 1.3 – 1.9 4.2 – 5.9 1.5 4.6 0.2 0.6
Spur/branch length ratio 7 17% – 22% – 19% – 2% –
Claw 3 heights
Branch 10 7.7 – 8.7 22.0 – 26.9 8.2 24.8 0.4 1.5
Spur 7 1.4 – 1.7 4.0 – 5.4 1.5 4.7 0.1 0.5
Spur/branch length ratio 7 17% – 21% – 19% – 2% –
Claw 4 heights
Branch 10 8.5 – 10.9 26.3 – 33.2 9.9 29.7 0.7 1.9
Spur 6 1.7 – 2.4 4.8 – 7.4 2.0 6.0 0.3 0.9
Spur/branch length ratio 6 17% – 24% – 21% – 3% –

Larvae (i.e. the first instar; measurements in Table 8). Clear morphometric gap between juveniles and larvae exists (compare Tables 7, 8). Body appendage configuration A-Cd-Dd-E (Fig. 9B). Anterior portions of paired segmental plates weakly sclerotised. Gonopore and anus absent.

Table 8.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of larvae of Echiniscus tropicalis (population ID.939) mounted in Hoyer’s medium (N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation).

Character N Range Mean SD
µm sp µm sp µm sp
Body length 3 110 – 124 559 – 574 119 567 8 7
Scapular plate length 3 19.4 – 22.0 – 21.0 – 1.4 –
Head appendages lengths
Cirrus internus 3 4.2 – 4.6 20.9 – 21.6 4.5 21.3 0.2 0.4
Cephalic papilla 3 3.7 – 4.1 18.5 – 19.1 3.9 18.7 0.2 0.3
Cirrus externus 2 6.0 – 6.4 29.6 – 30.9 6.2 30.3 0.3 0.9
Clava 3 2.6 – 3.1 13.4 – 14.4 2.9 13.9 0.3 0.5
Cirrus A 3 13.3 – 15.5 60.9 – 71.8 14.1 67.1 1.2 5.6
Cirrus A/Body length ratio 3 11% – 13% – 12% – 1% –
Body appendages lengths
Spine Cd 3 0.9 – 3.2 4.1 – 15.5 2.4 11.5 1.3 6.4
Spine Dd 3 3.2 – 6.0 16.5 – 27.8 4.8 22.8 1.5 5.8
Spine E 3 3.9 – 5.5 20.1 – 25.0 4.7 22.4 0.8 2.5
Spine on leg I length 3 1.2 – 1.6 6.2 – 7.4 1.5 7.0 0.2 0.7
Papilla on leg IV length 3 1.7 – 2.0 8.8 – 9.1 1.9 8.9 0.2 0.2
Number of teeth on the collar 3 6 – 7 – 6.7 – 0.6 –
Claw 1 heights
Branch 3 5.3 – 5.8 26.4 – 27.3 5.6 26.7 0.3 0.5
Spur 3 1.1 – 1.4 5.7 – 6.5 1.3 6.2 0.2 0.4
Spur/branch length ratio 3 21% – 25% – 23% – 2% –
Claw 2 heights
Branch 3 5.1 – 5.5 24.5 – 26.3 5.3 25.4 0.2 0.9
Spur 3 1.0 – 1.1 4.6 – 5.7 1.1 5.1 0.1 0.5
Spur/branch length ratio 3 18% – 22% – 20% – 2% –
Claw 3 heights
Branch 3 5.1 – 5.7 24.5 – 26.4 5.4 25.7 0.3 1.0
Spur 3 1.2 – 1.3 5.5 – 6.2 1.2 5.9 0.1 0.4
Spur/branch length ratio 3 22% – 24% – 23% – 1% –
Claw 4 heights
Branch 3 6.0 – 6.1 27.7 – 31.4 6.1 29.0 0.1 2.1
Spur 2 1.2 – 1.6 5.5 – 7.4 1.4 6.4 0.3 1.4
Spur/branch length ratio 2 20% – 27% – 23% – 5% –

Eggs. One egg per exuviae was found in few examined exuviae.

DNA sequences and phylogenetic position

Two haplotypes in all markers were found, corresponding with the populations ID.032 and ID.939: 18S rRNA (MW327546, MW327547), 28S rRNA (MW327542, MW327543), ITS-2 (MW327549, MW327550), with the exception of ITS-1, characterised by one haplotype (MW327551, MW327552). The sister species of E. tropicalis within the spinulosus complex is E. siticulosus (Fig. 8).

Phenotypic differential diagnosis

Echiniscus tropicalis was originally described based on two adult females (Binda and Pilato 1995). We compared the newly found Southeast Asian specimens with the microphotographs of the holotype that confirmed our suspicions after reading the description, i.e. the lack of sound morphological discrepancies between the type material from the Seychelles and abundant material from the Malay Archipelago and the Malay Peninsula. The only difference is the serration of spines E that may be well-developed in Asian populations (Fig. 10), whereas this trait was not reported by Binda and Pilato (1995). The original description mentions “primary and secondary points” in the paratype = a potential ramification. As there is a considerable intrapopulation variability regarding this trait, the Seychellois and Asian populations should be ascertained as conspecific unless DNA data from the Seychelles reject this hypothesis.

There is a plethora of differences between adult females of E. insularis sp. nov. and E. tropicalis after the description of the latter was supplemented with new data:

  • the presence of supernumerary spicules along the margins of dorsal plates and in the caudal incisions (present in E. insularis sp. nov. vs absent in E. tropicalis);
  • the presence of pedal plates (absent in E. insularis sp. nov. vs present in E. tropicalis);
  • the relative length of cirrus A (86.1– 106.2 in E. insularis sp. nov. vs 41.1– 79.3 in E. tropicalis);
  • the absolute lengths of lateral spines B– D (B 2.5–3.2 μm, C 2.0–5.2 μm, D 2.5–4.0 μm in E. insularis sp. nov. vs B 4.3–12.7 μm, C 6.5–14.7 μm, D 5.7–13.8 μm in E. tropicalis);
  • the presence of males (present in E. insularis sp. nov. vs absent in E. tropicalis);
  • additionally, the spine E is frequently serrated in E. tropicalis (smooth in E. insularis sp. nov.).

Echiniscus perarmatus Murray, 1907

Material

Single adult female and a juvenile used for DNA sequencing (juvenile retrieved as a hologenophore on slide MU.001.23), larva on slide MU.001.01.

Remarks

This pantropical species (McInnes 1994) will likely appear to be one of the most common members of Echiniscidae in tropical climates, providing that the conspecificity of populations originating from different continents is demonstrated (data in preparation).

Genus: Pseudechiniscus Thulin, 1911

Subgenus: Meridioniscus Gąsiorek et al., 2021

Pseudechiniscus mascarenensis sp. nov. Kiosya, Vončina & Gąsiorek

http://zoobank.org/E5E6328D-D431-4BEA-88CB-0C24F6172B65
Figures 12, 13, 14, 15, 16, 17, Tables 9, 10, 11, 12

Pseudechiniscus sp. 5 in Gąsiorek et al. (2021)

Locus typicus and type material

ca. 20°22'S, 57°29'E, 580 m asl; Sophie Nature Walk, vicinity of Mare aux Vacoas (Plaines Wilhems, Mauritius, Mascarene Archipelago, Western Indian Ocean); mosses from tree trunks. Holotype (mature female on slide MU.001.04), allotype (mature male on slide MU.001.05), sixty paratypic females, seven paratypic males, ten juveniles, and six larvae (slides MU.001.01–21). Single hologenophore on slide MU.001.22. All deposited in the Department of Invertebrate Evolution.

Etymology

The name indicates the Mascarenes, terra typica of the new species. Adjective in the nominative singular.

Description

Mature females (i.e. from the third instar onwards; measurements in Table 9). Body yellow to orange, with minute, round black eyes absent after mounting (Fig. 12A). Elongated (dactyloid) cephalic papillae (secondary clavae) and elongated (primary) clavae (Figs 12A, 13, 15, 16); peribuccal cirri with poorly developed cirrophores. Cirrus A short, with cirrophore.

Table 9.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of mature females of Pseudechiniscus mascarenensis sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation).

Character N Range Mean SD Holotype
µm sp µm sp µm sp µm sp
Body length 10 151 – 177 621 – 843 163 712 9 64 167 732
Scapular plate length 10 21.0 – 24.8 – 23.0 – 1.4 – 22.8 –
Head appendages lengths
Cirrus internus 10 5.4 – 7.6 23.3 – 32.9 6.7 29.2 0.6 2.9 6.8 29.8
Cephalic papilla 10 4.3 – 5.7 17.3 – 25.2 5.0 21.8 0.5 2.3 4.4 19.3
Cirrus externus 10 7.7 – 13.0 33.2 – 56.5 10.8 47.3 1.6 7.7 11.5 50.4
Clava 10 3.4 – 5.2 13.9 – 21.2 4.2 18.2 0.5 2.3 4.0 17.5
Cirrus A 9 13.8 – 23.4 58.1 – 95.5 18.9 82.9 3.0 14.6 20.5 89.9
Cirrus A/Body length ratio 9 9% – 13% – 12% – 2% – 12% –
Papilla on leg IV length 10 1.5 – 2.4 7.0 – 11.0 2.0 8.9 0.3 1.2 2.1 9.2
Claw 1 heights
Branch 10 6.9 – 8.6 29.7 – 39.5 7.8 34.1 0.6 3.0 8.0 35.1
Spur 9 1.3 – 2.1 5.7 – 8.6 1.6 7.2 0.3 1.0 1.3 5.7
Spur/branch length ratio 9 16% – 25% – 21% – 3% – 16% –
Claw 2 heights
Branch 10 6.8 – 8.7 29.3 – 38.6 7.8 33.9 0.6 2.9 7.8 34.2
Spur 9 1.2 – 1.8 5.2 – 7.6 1.5 6.4 0.2 0.8 1.4 6.1
Spur/branch length ratio 9 17% – 25% – 19% – 3% – 18% –
Claw 3 heights
Branch 10 6.5 – 8.4 28.9 – 40.0 7.6 33.3 0.7 3.2 7.6 33.3
Spur 8 1.2 – 1.7 5.6 – 7.2 1.5 6.4 0.2 0.5 1.4 6.1
Spur/branch length ratio 8 18% – 24% – 20% – 2% – 18% –
Claw 4 heights
Branch 10 7.5 – 9.1 30.2 – 42.4 8.3 36.2 0.6 3.4 8.0 35.1
Spur 6 1.3 – 2.2 6.0 – 9.0 1.8 7.6 0.4 1.3 1.8 7.9
Spur/branch length ratio 6 17% – 25% – 21% – 3% – 23% –
Figure 12.

Habitus of Pseudechiniscus mascarenensis sp. nov. (PCM): A female, dorsolateral view, B, C males, dorsal view. Scale bars in μm.

Dorsal plates are both poorly sclerotised and demarcated from each other, with the Pseudechiniscus-type sculpturing, i.e. endocuticular pillars protruding through the epicuticle and visible as dark dots in PCM (Fig. 12A). Striae present, but not visible in SEM (Figs 15A, 16). Epicuticular ornamentation absent. The cephalic plate pentapartite, with the anterior bi-halved portion and three posterior portions, roughly equal in size. The cervical (neck) plate absent. The scapular plate with sutures, separating wide anterior portion and four rectangular posterior portions. Three median plates: m1 and m3 unipartite, the latter indistinctly merged with the anterior margin of the pseudosegmental plate IV’ (Fig. 12A), clearly delimited in SEM (Fig. 15A); m2 bipartite and large. Four pairs of lateral intersegmental platelets flanking the boarders of m1–2 (Figs 12A, 16). Two pairs of large segmental plates. The pseudosegmental plate IV’ undivided by a median longitudinal suture; the posterior margin of the plate sinusoid and smooth. The caudal (terminal) plate with short, very poorly marked incisions (Figs 15A, 16).

Ventral cuticle with a pronounced species-specific pattern reaching the lateroventral sides of the body (Figs 12A, 13, 14, 15B), being a typical reticulum composed of belts of pillars. The pattern is relatively stable and well developed in the majority of individuals. The subcephalic zone with a wide belt of pillars. No epicuticular thickenings. Sexpartite gonopore located anterior to legs IV and a trilobed anus between legs IV.

Figure 13.

Ventral sculpturing pattern of female of Pseudechiniscus mascarenensis sp. nov. (PCM). Scale bar in μm.

Figure 14.

Schematic ventral sculpturing pattern of female of Pseudechiniscus mascarenensis sp. nov.

Figure 15.

Habitus of females of Pseudechiniscus mascarenensis sp. nov. (SEM): A dorsal view, B ventral view. Scale bars in μm.

Pedal plates and dentate collar IV absent; instead large patches of pillars are present centrally on each leg (Fig. 12A). Pulvini faint. Papilla on leg I absent (Figs 12A, 13, 16) and papilla on leg IV present (Figs 12A, 16, 17D). Claws I–IV of similar heights. External claws on all legs smooth. Internal claws with spurs positioned at ca. 1/5 of the claw height and directed downwards (Fig. 17).

Figure 16.

Habitus of females of Pseudechiniscus mascarenensis sp. nov. (SEM) in lateral view. Scale bars in μm.

Figure 17.

Claws of Pseudechiniscus mascarenensis sp. nov.: A claws I (PCM), B claws II (SEM), C claws III (PCM), D claws IV with papilla (SEM). Scale bars in μm.

Mature males (i.e. from the second or third instar onwards; measurements in Table 10). Clearly smaller than females (compare Tables 9, 10). The posterior margin of the pseudosegmental plate IV’ bears two weakly developed lobes joined at their bases (Fig. 12B, C). Gonopore circular.

Table 10.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of mature males of Pseudechiniscus mascarenensis sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation).

Character N Range Mean SD Allotype
µm sp µm sp µm sp µm sp
Body length 6 118 – 146 605 – 670 137 650 10 24 146 652
Scapular plate length 6 17.6 – 22.4 – 21.1 – 1.8 – 22.4 –
Head appendages lengths
Cirrus internus 6 5.1 – 7.9 23.9 – 36.9 6.4 30.7 1.0 5.1 7.9 35.3
Cephalic papilla 6 3.5 – 4.9 19.9 – 23.0 4.5 21.2 0.5 1.1 4.6 20.5
Cirrus externus 5 8.0 – 10.0 37.2 – 52.3 9.3 44.9 0.8 5.5 ? ?
Clava 6 3.5 – 4.6 18.3 – 21.6 4.1 19.4 0.3 1.2 4.1 18.3
Cirrus A 5 13.8 – 18.8 73.2 – 85.9 16.8 79.9 2.0 5.2 16.4 73.2
Cirrus A/Body length ratio 5 11% – 14% – 12% – 1% – 11% –
Papilla on leg IV length 6 1.7 – 2.4 7.6 – 11.2 2.0 9.5 0.2 1.2 1.7 7.6
Claw 1 heights
Branch 6 6.7 – 8.3 30.9 – 38.1 7.4 35.1 0.6 2.8 8.3 37.1
Spur 3 1.0 – 1.5 4.7 – 7.0 1.3 6.0 0.3 1.2 ? ?
Spur/branch length ratio 3 14% – 20% – 18% – 3% – ? –
Claw 2 heights
Branch 6 6.2 – 7.5 29.1 – 35.2 6.9 33.0 0.5 2.3 7.2 32.1
Spur 5 1.1 – 1.5 5.2 – 7.4 1.3 6.3 0.2 1.0 1.5 6.7
Spur/branch length ratio 5 15% – 21% – 19% – 3% – 21% –
Claw 3 heights
Branch 6 6.3 – 7.2 29.6 – 35.8 6.8 32.6 0.4 2.1 7.1 31.7
Spur 3 1.2 – 1.5 5.4 – 6.7 1.3 6.1 0.2 0.7 1.5 6.7
Spur/branch length ratio 3 18% – 21% – 19% – 2% – 21% –
Claw 4 heights
Branch 6 6.6 – 8.1 31.3 – 37.7 7.5 35.9 0.6 2.8 7.0 31.3
Spur 2 1.5 – 1.5 6.7 – 7.0 1.5 6.8 0.0 0.2 1.5 6.7
Spur/branch length ratio 2 19% – 21% – 20% – 2% – 21% –

Juveniles (i.e. from the second instar onwards; measurements in Table 11). Morphometric gap exists between adult females and juveniles. Qualitatively similar to adults. Gonopore absent.

Table 11.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of juveniles of Pseudechiniscus mascarenensis sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation).

Character N Range Mean SD
µm sp µm sp µm sp
Body length 5 115 – 129 635 – 726 124 672 5 33
Scapular plate length 5 17.5 – 19.3 – 18.4 – 0.7 –
Head appendages lengths
Cirrus internus 5 5.2 – 6.9 27.8 – 38.1 5.9 32.3 0.7 4.4
Cephalic papilla 5 3.4 – 3.9 17.6 – 21.2 3.5 19.3 0.2 1.4
Cirrus externus 5 6.9 – 7.8 38.1 – 42.3 7.5 40.7 0.4 1.6
Clava 5 2.8 – 3.9 15.0 – 21.2 3.3 18.0 0.5 2.7
Cirrus A 5 12.7 – 16.4 65.8 – 89.1 14.3 77.7 1.9 10.0
Cirrus A/Body length ratio 5 10% – 13% – 12% – 2% –
Papilla on leg IV length 4 1.5 – 2.0 8.0 – 10.9 1.8 9.5 0.3 1.4
Claw 1 heights
Branch 5 6.1 – 6.4 33.2 – 34.9 6.3 34.0 0.1 0.8
Spur 2 1.2 – 1.3 6.2 – 7.4 1.3 6.8 0.1 0.9
Spur/branch length ratio 2 19% – 21% – 20% – 2% –
Claw 2 heights
Branch 5 5.2 – 5.8 28.0 – 31.5 5.6 30.3 0.3 1.5
Spur 3 1.3 – 1.4 6.7 – 7.6 1.3 7.1 0.1 0.5
Spur/branch length ratio 3 22% – 24% – 24% – 1% –
Claw 3 heights
Branch 5 5.6 – 6.4 29.5 – 35.4 6.0 32.5 0.3 2.6
Spur 3 1.1 – 1.3 5.7 – 7.1 1.2 6.5 0.1 0.7
Spur/branch length ratio 3 19% – 21% – 20% – 1% –
Claw 4 heights
Branch 5 6.4 – 6.9 33.2 – 37.7 6.6 36.0 0.2 1.9
Spur 2 1.1 – 1.2 6.0 – 6.6 1.2 6.3 0.1 0.5
Spur/branch length ratio 2 16% – 18% – 17% – 2% –

Larvae (i.e. the first instar; measurements in Table 12). Morphometric gap exists between juveniles and larvae. Gonopore and anus absent.

Table 12.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of larvae of Pseudechiniscus mascarenensis sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, Range refers to the smallest and the largest structure among all measured specimens; SD – standard deviation).

Character N Range Mean SD
µm sp µm sp µm sp
Body length 5 89 – 105 603 – 699 99 643 6 43
Scapular plate length 5 14.3 – 17.4 – 15.5 – 1.4 –
Head appendages lengths
Cirrus internus 4 3.7 – 5.2 25.9 – 30.6 4.5 28.7 0.6 2.1
Cephalic papilla 5 2.8 – 3.6 17.2 – 25.2 3.2 21.1 0.4 3.6
Cirrus externus 5 5.2 – 6.6 31.9 – 45.5 5.7 37.3 0.6 6.0
Clava 5 2.5 – 3.4 14.4 – 20.5 2.7 17.6 0.4 2.2
Cirrus A 4 10.3 – 14.2 59.8 – 99.3 11.7 75.8 1.8 18.6
Cirrus A/Body length ratio 4 10% – 14% – 12% – 2% –
Papilla on leg IV length 4 1.1 – 1.5 6.6 – 9.1 1.3 8.3 0.2 1.1
Claw 1 heights
Branch 5 5.0 – 5.9 30.7 – 38.1 5.4 35.0 0.4 3.0
Spur 4 1.0 – 1.6 6.0 – 11.2 1.2 8.2 0.3 2.2
Spur/branch length ratio 4 20% – 30% – 23% – 4% –
Claw 2 heights
Branch 5 4.6 – 5.1 28.7 – 35.0 5.0 32.2 0.2 2.7
Spur 5 0.9 – 1.5 6.1 – 10.5 1.1 7.4 0.2 1.8
Spur/branch length ratio 5 18% – 30% – 23% – 5% –
Claw 3 heights
Branch 5 4.7 – 5.3 29.5 – 36.4 5.0 32.1 0.3 2.6
Spur 2 0.9 – 1.0 6.2 – 6.8 1.0 6.5 0.1 0.4
Spur/branch length ratio 2 19% – 21% – 20% – 2% –
Claw 4 heights
Branch 5 5.4 – 6.2 32.5 – 43.4 5.7 37.1 0.4 4.0
Spur 1 1.3 – 1.3 8.8 – 8.8 1.3 8.8 ? ?
Spur/branch length ratio 1 24% – 24% – 24% – ? –

Eggs. One egg per exuviae was found in few examined exuviae.

DNA sequences and phylogenetic position

Single haplotypes in 18S rRNA (MW031972), 28S rRNA (MW032061), and ITS-1 (MW032151) were found. Pseudechiniscus mascarenensis sp. nov. has no close relatives according to the phylogeny presented in Gąsiorek et al. (2020) (see fig. 2 therein), constituting a separate evolutionary lineage within the subgenus Meridioniscus.

Phenotypic differential diagnosis

The species must be compared to other members of Meridioniscus with no projections on the pseudosegmental plate IV’ or with rudimentarily developed projections. Pseudechiniscus mascarenensis sp. nov. is differentiated from:

  • P. angelusalas Roszkowska et al., 2020, described from Madagascar, by the body length (151–177 μm in females of P. mascarenensis sp. nov. vs 113–143 μm in females of P. angelusalas), the cirrus A/body length ratio (9–13% in females of P. mascarenensis sp. nov. vs 19–22% in females of P. angelusalas), and by the division of the pseudosegmental plate IV’ (undivided in P. mascarenensis sp. nov. vs with median longitudinal suture in P. angelusalas);
  • P. dastychi Roszkowska et al., 2020, described from the Argentine Islands (maritime Antarctic), by the presence of males (present in P. mascarenensis sp. nov. vs absent in P. dastychi), and by the division of the pseudosegmental plate IV’ (undivided in P. mascarenensis sp. nov. vs with median longitudinal suture in P. dastychi);
  • P. indistinctus Roszkowska et al., 2020, described from Norway, by the division of the pseudosegmental plate IV’ (undivided in P. mascarenensis sp. nov. vs with median longitudinal suture in P. indistinctus), and by the presence of males (present in P. mascarenensis sp. nov. vs absent in P. indistinctus);
  • P. santomensis Fontoura et al., 2010, considered endemic to the island São Tomé (Gulf of Guinea), by the presence of males (present in P. mascarenensis sp. nov. vs absent in P. santomensis), and the morphology of the posterior margin of pseudosegmental plate IV’ in females (smooth in P. mascarenensis sp. nov. vs with two projections in P. santomensis, as in males of P. mascarenensis sp. nov.); overall, these two species are most similar within the genus.

Moreover, only the ventral sculpturing pattern of P. santomensis resembles that of P. mascarenensis sp. nov.; the remaining species have a very different ventral arrangement of pillars. Pseudechiniscus juanitae de Barros, 1939 should be treated as unidentifiable due to the lack of knowledge on its morphology (Grobys et al. 2020), although one attempt was made to characterise this species based on individuals from Central America (Pilato and Lisi 2006; Tumanov 2020), whereas its locus typicus lies in Brazil. Consequently, it is not included within the differential diagnosis.

Discussion

The fauna of Mauritius has previously been illustrative for an isolated oceanic island, consisting of a small number of mostly endemic species (Cheke and Hume 2008; Kehlmaier et al. 2019). However, many native species have been extirpated and replaced by allochthonous, often invasive taxa, a process which has been documented for numerous islands (Drake et al. 2002). Although the interactions between tardigrades inhabiting a given microhabitat are poorly understood (Meyer et al. 2020), in some cases it is easy to pinpoint with high level of certainty that a species is not native to a region. For example, Echiniscus testudo (Doyère, 1840) was reported from the Seychelles (Pilato et al. 2002), and it is highly probable that it was brought there by the Europeans during the colonialism era. The impact of such successfully colonising tardigrade species on local communities is unknown.

Our contribution provides first faunistic data on limno-terrestrial tardigrades for Mauritius, and reveals one species (E. perarmatus) probably widely distributed in the tropics (McInnes 1994). This concurs with pantropical records of another echiniscid, E. lineatus (Gąsiorek et al. 2019), and the wide geographic range of E. tropicalis (Fig. 18). The remaining two species are potentially endemic to the island, and the morphological similarity of E. insularis sp. nov. and E. tropicalis (Binda and Pilato 1995) would suggest that autochthonous tardigrades inhabiting Mauritius and Seychelles likely share a common origin. However, E. tropicalis is not closely related to E. insularis sp. nov. since its immediate kin is E. siticulosus (Fig. 8), an Australian endemic. Niedbała (2017) showed that oribatid mites of the Madagascan region are mostly endemic, but, at the same time, its fauna is more similar to the Afrotropical than to the Oriental realm. Given that the wind dispersal is an important movement mechanism for both oribatids and tardigrades (Lehmitz et al. 2011; Nelson et al. 2018; Gąsiorek et al. 2019), it is probable that the closest relatives of endemic Mauritian echiniscids should also be sought in Africa.

Figure 18.

Distribution of species discussed in the present study. Map downloaded from www.freeworldmaps.net.

The supernumerary dorsal appendages of E. insularis sp. nov. are a morphological peculiarity, atypical for Echiniscus. Other species exhibiting appendages along the plate margins are very rare: E. africanus, E. baloghi, and E. semifoveolatus (Murray 1907; Iharos 1973; Ito 1993; Gąsiorek and Vončina 2019). These appendages, usually in the form of spicules, should be regarded as morphological convergence, appearing at the same time in the distantly related genus Acanthechiniscus (Vecchi et al. 2016). However, in the new Mauritian species, these spicules grow out of the surface of the dorsal plates, which is not present in any other echiniscids. Together with the small body size as for an Echiniscus, the presence of these spicules make E. insularis sp. nov. easily distinguishable and characteristic taxon. Contrarily, P. mascarenensis sp. nov. is a typical representative of Pseudechiniscus, more precisely of the subgenus Meridioniscus, which has been poorly represented in the molecular dataset under the term “novaezeelandiae group” (Cesari et al. 2020), until recently when Pseudechiniscus was divided into subgenera thanks to augmenting the phylogenetic inference for this genus based on a large molecular dataset (Gąsiorek et al. 2021). In summary, this limited sampling in the centre of Mauritius reflects the restricted knowledge about insular tardigrade faunas not only in the region of Indian Ocean, but throughout the world.

Acknowledgements

We are most grateful to Olena Garmish, Ekaterina Vasilenko, Łukasz Michalczyk, Łukasz Krzywański, Łukasz Skoczylas, and Tan Pal Chun for providing us with the samples. We deeply appreciate help of Oscar Lisi who kindly shared photos of the holotype of E. tropicalis with us for comparisons. The Deputy Editor-in-Chief Andreas Schmidt-Rhaesa, Diane Nelson and an anonymous reviewer helped in improving the manuscript, and are gratefully acknowledged. The study was performed in the framework of Preludium (2019/33/N/NZ8/02777 to PG supervised by ŁM) and Sonata Bis (2016/22/E/NZ8/00417 to ŁM) grants funded by the National Science Centre. Sampling in Asia was supported by the Polish Ministry of Science and Higher Education (DI2015 014945 to PG). PG is a recipient of the ‘Etiuda’ (2020/36/T/NZ8/00360, funded by the National Science Centre) and ‘Start’ stipends (START 28.2020, funded by the Foundation for Polish Science). Łukasz Michalczyk is acknowledged for advice and constant support.

References

  • Bartels PJ, Apodaca JJ, Mora C, Nelson DR (2016) A global biodiversity estimate of a poorly known taxon: phylum Tardigrada. Zoological Journal of the Linnean Society 178: 730–736. https://doi.org/10.1111/zoj.12441
  • Blaxter M, Elsworth B, Daub J (2003) DNA taxonomy of a neglected animal phylum: an unexpected diversity of tardigrades. Proceedings of the Royal Society B 271(Supplement): 189–192. https://doi.org/10.1098/rsbl.2003.0130
  • Casquet J, Thebaud C, Gillespie RG (2012) Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Molecular Ecology Resources 12: 136–141. https://doi.org/10.1111/j.1755-0998.2011.03073.x
  • Cesari M, Montanari M, Kristensen RM, Bertolani R, Guidetti R, Rebecchi L (2020) An integrated study of the biodiversity within the Pseudechiniscus suillus–facettalis group (Heterotardigrada: Echiniscidae). Zoological Journal of the Linnean Society 188: 717–732. https://doi.org/10.1093/zoolinnean/zlz045
  • Cheke A, Hume J (2008) Lost land of the dodo: The ecological history of Mauritius, Réunion, and Rodrigues. Yale University Press, New Haven.
  • Dabert J, Ehrnsberger R, Dabert M (2008) Glaucalges tytonis sp. nov. (Analgoidea: Xolalgidae) from the barn owl Tyto alba (Strigiformes: Tytonidae): compiling morphology with DNA barcode data for taxa descriptions in mites (Acari). Zootaxa 1719: 41–52. https://doi.org/10.11646/zootaxa.1719.1.2
  • da Cunha AX, do Nascimento Ribeiro F (1962) A fauna de tardígrados da Ilha da Madeira. Memórias e Estudos do Museu Zoológico da Universidade de Coimbra 279: 1–24.
  • Dastych H (1980) Niesporczaki (Tardigrada) Tatrzańskiego Parku Narodowego. Monografie Fauny Polski 9: 1–232.
  • Dastych H (1999) A new species of the genus Mopsechniscus Du Bois-Reymond Marcus, 1944 (Tardigrada) from the Venezuelan Andes. Acta biologica Benrodis 10: 91–101.
  • de Barros R (1939) Pseudechiniscus juanitae, nova espécie de tardigrado. Boletim Biológico, New Series 4: 367–368.
  • De Zio Grimaldi S, Lamarca A, Gallo D’Addabbo M, Pietanza R (1999) Florarctinae of Asdhu Island, Maldives, Indian Ocean (Tardigrada, Heterotardigrada). Italian Journal of Zoology 66: 383–391. https://doi.org/10.1080/11250009909356282
  • Doyère M (1840) Mémoire sur les Tardigrades. Annales des Sciences Naturalles, Zoologia, Paris, Series 2, 14: 269–362.
  • Faurby S, Jørgensen A, Kristensen RM, Funch P (2012) Distribution and speciation in marine intertidal tardigrades: testing the roles of climatic and geographical isolation. Journal of Biogeography 39: 1596–1607. https://doi.org/10.1111/j.1365-2699.2012.02720.x
  • Fontoura P, Pilato G, Lisi O (2010) First record of Tardigrada from São Tomé (Gulf of Guinea, Western Equatorial Africa) and description of Pseudechiniscus santomensis sp. nov. (Heterotardigrada: Echiniscidae). Zootaxa 2564: 31–42. https://doi.org/10.11646/zootaxa.2564.1.2
  • Gąsiorek P, Degma P (2018) Three Echiniscidae species (Tardigrada: Heterotardigrada) new to the Polish fauna, with the description of a new gonochoristic Bryodelphax Thulin, 1928. Zootaxa 4410: 77–96. https://doi.org/10.11646/zootaxa.4410.1.4
  • Gąsiorek P, Jackson KJ, Meyer H, Zając K, Nelson DR, Kristensen RM, Michalczyk Ł (2019) Echiniscus virginicus complex: the first case of pseudocryptic allopatry and pantropical distribution in tardigrades. Biological Journal of the Linnean Society 128: 789–805. https://doi.org/10.1093/biolinnean/blz147
  • Gąsiorek P, Stec D, Morek W, Michalczyk Ł (2017) An integrative redescription of Echiniscus testudo (Doyère, 1840), the nominal taxon for the class Heterotardigrada (Ecdysozoa: Panarthropoda: Tardigrada). Zoologischer Anzeiger 270: 107–122. https://doi.org/10.1016/j.jcz.2017.09.006
  • Gąsiorek P, Stec D, Zawierucha K, Kristensen RM, Michalczyk Ł (2018) Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa 4472: 261–297. https://doi.org/10.11646/zootaxa.4472.2.3
  • Gąsiorek P, Vončina K, Zając K, Michalczyk Ł (2021) Phylogeography and morphological evolution of Pseudechiniscus (Heterotardigrada: Echiniscidae). Scientific Reports 11: 7606. https://doi.org/10.1038/s41598-021-84910-6
  • Grimaldi De Zio S, D’Addabbo Gallo M, Morone de Lucia MR, Daddabbo L (1987) Marine Arthrotardigrada and Echiniscoidea (Tardigrada, Heterotardigrada) from the Indian Ocean. Bollettino di zoologia 54: 347–357. https://doi.org/10.1080/11250008709355608
  • Grobys D, Roszkowska M, Gawlak M, Kmita H, Kepel A, Kepel M, Parnikoza I, Bartylak T, Kaczmarek Ł (2020) High diversity in the Pseudechiniscus suillus–facettalis complex (Heterotardigrada: Echiniscidae) with remarks on the morphology of the genus Pseudechiniscus. Zoological Journal of the Linnean Society 188: 733–752. https://doi.org/10.1093/zoolinnean/zlz171
  • Guidetti R, Cesari M, Bertolani R, Altiero T, Rebecchi L (2019) High diversity in species, reproductive modes and distribution within the Paramacrobiotus richtersi complex (Eutardigrada, Macrobiotidae). Zoological Letters 5: 1. https://doi.org/10.1186/s40851-018-0113-z
  • Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35: 518–522. https://doi.org/10.1093/molbev/msx281
  • Iharos G (1973) Neuere Daten zur Kenntnis der Tardigraden-Fauna von Neuguinea. Opuscula Zoologica, Budapest 11: 65–73.
  • Ito M (1993) Taxonomic study on the class Heterotardigrada (Tardigrada) from the northern slope of Mt. Fuji, Central Japan. Edaphologia 50: 1–13.
  • Jørgensen A, Kristensen RM, Møbjerg N (2018) Phylogeny and integrative taxonomy of Tardigrada. In: Schill R (Ed.) Water bears: The biology of tardigrades. Zoological Monographs, 2, chapter 3. Springer, Cham, 95–114. https://doi.org/10.1007/978-3-319-95702-9_3
  • Kaczmarek Ł, Roszkowska M, Poprawa I, Janelt K, Kmita H, Gawlak M, Fiałkowska E, Mioduchowska M (2020) Integrative description of bisexual Paramacrobiotus experimentalis sp. nov. (Macrobiotidae) from Republic of Madagascar (Africa) with microbiome analysis. Molecular Phylogenetics and Evolution 145: 106730. https://doi.org/10.1016/j.ympev.2019.106730
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285
  • Kehlmaier C, Graciá E, Campbell PD, Hofmeyr MD, Schweiger S, Martínez-Silvestre A, Joyce W, Fritz U (2019) Ancient mitogenomics clarifies radiation of extinct Mascarene giant tortoises (Cylindraspis spp.). Scientific Reports 9: 17487. https://doi.org/10.1038/s41598-019-54019-y
  • Marcus E (1927) Zur Anatomie und Ökologie mariner Tardigraden. Zoologische Jahrbücher Abteilung für Systematik 53: 487–558.
  • Meyer HA, Larsen HE, Akobi NO, Broussard G (2020) Predator and prey detection in two species of water bear (Tardigrada). Zoological Journal of the Linnean Society 188: 860–864. https://doi.org/10.1093/zoolinnean/zlz141
  • Mironov SV, Dabert J, Dabert M (2012) A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the long-tailed tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa 3253: 54–61. https://doi.org/10.11646/zootaxa.3253.1.2
  • Morek W, Michalczyk Ł (2020) First extensive multilocus phylogeny of the genus Milnesium (Tardigrada) reveals no congruence between genetic markers and morphological traits. Zoological Journal of the Linnean Society 188: 681–693. https://doi.org/10.1093/zoolinnean/zlz040
  • Motala SM, Krell F-T, Mungroo Y, Donovan SE (2007) The terrestrial arthropods of Mauritius: a neglected conservation target. Biodiversity and Conservation 16: 2867–2881. https://doi.org/10.1007/s10531-006-9050-9
  • Nelson DR, Bartels PJ, Guil N (2018) Tardigrade ecology. In: Schill R (Ed.) Water bears: The biology of tardigrades. Zoological Monographs, 2, chapter 7. Springer, Cham, 163–210. https://doi.org/10.1007/978-3-319-95702-9_7
  • Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Molecular Biology and Evolution 32: 268–274. https://doi.org/10.1093/molbev/msu300
  • Pilato G, Binda MG, Lisi O (2002) Notes on tardigrades of the Seychelles with the description of two new species. Bollettino dell'Accademia Gioenia di Scienze Naturali, Catania 35: 503–517.
  • Pilato G, Binda MG, Lisi O (2004) Notes on some tardigrades of the Seychelles with the description of three new species. Italian Journal of Zoology 71: 171–178. https://doi.org/10.1080/11250000409356569
  • Pleijel F, Jondelius U, Norlinder E, Nygren A, Oxelman B, Schander C, Sundberg P, Thollesson M (2008) Phylogenies without roots? A plea for the use of vouchers in molecular studies. Molecular Phylogenetics and Evolution 48: 369–371. https://doi.org/10.1016/j.ympev.2008.03.024
  • Richters F (1903) Nordische Tardigraden. Zoologischer Anzeiger 27: 168–172.
  • Richters F (1926) Tardigrada. In: Kükenthal W, Krumbach T (Eds) Handbuch der Zoologie. Vol. 3. Walter de Gruyter & Co., Berlin and Leipzig, 58–61 pp.
  • Roszkowska M, Grobys D, Bartylak T, Gawlak M, Kmita H, Kepel A, Kepel M, Parnikoza I, Kaczmarek Ł (2020) Integrative description of five Pseudechiniscus species (Heterotardigrada: Echiniscidae: the suillus-facettalis complex). Zootaxa 4763: 451–484. https://doi.org/10.11646/zootaxa.4763.4.1
  • Séméria Y (2003) Une espèce nouvelle de tardigrade pour l’Ile de La Reunion: Cornechiniscus madagascariensis Maucci. Bulletin mensuel de la Société linnéenne de Lyon 72: 233–234. https://doi.org/10.3406/linly.2003.13476
  • Stec D, Smolak R, Kaczmarek Ł, Michalczyk Ł (2015) An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052: 501–526. https://doi.org/10.11646/zootaxa.4052.5.1
  • Stec D, Zawierucha K, Michalczyk Ł (2017) An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland. Zootaxa 4300: 403–420. https://doi.org/10.11646/zootaxa.4300.3.4
  • Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ (2016) W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44: 232–235. https://doi.org/10.1093/nar/gkw256
  • Tumanov DV (2020) Analysis of non-morphometric morphological characters used in the taxonomy of the genus Pseudechiniscus (Tardigrada: Echiniscidae). Zoological Journal of the Linnean Society 188: 753–775. https://doi.org/10.1093/zoolinnean/zlz097
  • Vaidya G, Lohman DJ, Meier R (2011) SequenceMatrix: concatenation software for the fast assembly of multi‐gene datasets with character set and codon information. Cladistics 27: 171–180. https://doi.org/10.1111/j.1096-0031.2010.00329.x
  • Vecchi M, Cesari M, Bertolani R, Jönsson KI, Rebecchi L, Guidetti R (2016) Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invertebrate Systematics 30: 303–322. https://doi.org/10.1071/IS15033
  • Wełnicz W, Grohme MA, Kaczmarek Ł, Schill RO, Frohme M (2011) ITS-2 and 18S rRNA data from Macrobiotus polonicus and Milnesium tardigradum (Eutardigrada, Tardigrada). Journal of Zoological Systematics and Evolutionary Research 49: 34–39. https://doi.org/10.1111/j.1439-0469.2010.00595.x
  • Zeller C (2010) Untersuchung der Phylogenie von Tardigraden anhand der Genabschnitte 18S rDNA und Cytochrom c Oxidase Untereinheit 1 (COX I). MSc Thesis. Technische Hochschule Wildau, Germany, 105 pp.

Supplementary materials

Supplementary material 1 

Echiniscus insularis, MU.001+MU.002

Piotr Gąsiorek

Data type: Raw morphometric data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (260.54 kb)
Supplementary material 2 

Echiniscus tropicalis, ID.032

Piotr Gąsiorek

Data type: Raw morphometric data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (262.45 kb)
Supplementary material 3 

Echiniscus tropicalis, ID.939

Piotr Gąsiorek

Data type: Raw morphometric data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (251.95 kb)
Supplementary material 4 

Echiniscus tropicalis, SG.001

Piotr Gąsiorek

Data type: Raw morphometric data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (259.43 kb)
Supplementary material 5 

Pseudechiniscus mascarenensis, MU.001

Piotr Gąsiorek

Data type: Raw morphometric data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (205.47 kb)
Supplementary material 6 

GenBank accession numbers

Yevgen Kiosya, Katarzyna Vončina, Piotr Gąsiorek

Data type: GenBank accession numbers

Explanation note: GenBank accession numbers for the sequences used in the present study.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (18.31 kb)
login to comment