Research Article
Print
Research Article
A new species of Gonyosoma Wagler, 1828 (Serpentes, Colubridae), previously confused with G. prasinum (Blyth, 1854)
expand article infoShuo Liu‡, Mian Hou§, Ye Htet Lwin|, Qiaoyan Wang, Dingqi Rao‡
‡ Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China
§ Sichuan Normal University, Chengdu, China
| Southeast Asia Biodiversity Research Institute, Chinese Academy of Sciences, Nay Pyi Taw, Myanmar
¶ Research Institute of Xishuangbanna National Nature Reserve, Jinghong, China

Corresponding author: Dingqi Rao ( raodq@mail.kiz.ac.cn )

Academic editor: Alexander Haas
© 2021 Shuo Liu, Mian Hou, Ye Htet Lwin, Qiaoyan Wang, Dingqi Rao.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Liu S, Hou M, Lwin YH, Wang Q, Rao D (2021) A new species of Gonyosoma Wagler, 1828 (Serpentes, Colubridae), previously confused with G. prasinum (Blyth, 1854). Evolutionary Systematics 5(1): 129-139. https://doi.org/10.3897/evolsyst.5.66574
ZooBank: urn:lsid:zoobank.org:pub:03620F93-FD7A-4396-B158-554FD9866350
Open Access

Abstract

A new species of the genus Gonyosoma Wagler is described from Yunnan Province, China. The new species closely resembles G. prasinum (Blyth), but it is differentiated from the latter species by the following characters: precloacal plate divided, iris blue and inside of mouth greyish-white in life. Based on phylogenetic analyses of mitochondrial cytochrome b sequence data, the new species is recovered as the sister species to G. prasinum by Bayesian Inference and Maximum Likelihood analyses. The uncorrected pairwise distance between the new species and other species of the genus Gonyosoma ranged from 11.78% to 17.07% calculated using the mitochondrial cytochrome b sequence. This discovery increases the number of Gonyosoma species to seven.

Key Words

Htamanthi, morphology, phylogeny, systematics, taxonomy, Yunnan

Introduction

Once considered members of a single genus, Elaphe Fitzinger, the ratsnakes have been divided into a number of genera including Gonyosoma (Burbrink and Lawson 2007; Chen et al. 2017). The genus Gonyosoma currently includes six recognized species, namely G. boulengeri (Mocquard, 1897); G. frenatum (Gray, 1853); G. jansenii (Bleeker, 1859); G. margaritatum Peters, 1871; G. oxycephalum (Boie, 1827) and G. prasinum (Chen et al. 2014, 2017; Uetz et al. 2021).

Gonyosoma prasinum, a wholly green, arboreal snake (Schulz 1991, 1996; Das 2002, 2012), its type locality is in Assam, Northeastern India (Blyth 1854; Boulenger 1894; Smith 1943), and has been considered to be widely distributed in India, Bhutan, Myanmar, Thailand, Malaysia, Laos, Vietnam, and China (Schulz 1996; Zhao et al. 1998; Wu et al. 2002; Vogel and Pauwels 2004; Pauwels et al. 2006; Zhao 2006; Ziegler et al. 2007; Yang and Rao 2008; Hecht et al. 2013; Pham et al. 2014; Luu et al. 2020; Nguyen et al. 2020; Wang et al. 2020; Wangyal et al. 2020; Uetz et al. 2021).

During our fieldworks in southern China and northern Myanmar from 2019 to 2020, some specimens of Gonyosoma cf. prasinum were collected, six from Yunnan Province, China, and two from Htamanthi Wildlife Sanctuary, northwestern Myanmar, relatively close to the type locality of G. prasinum. The specimens from China and Myanmar showed some differences in scale counts and coloration in life. In addition, phylogenetically, the sequences of the specimens from China and from Myanmar were placed in two separate clades and had an obvious genetic divergence. Therefore, we treated the specimens from China and from Myanmar to be two distinct species.

The question was, which one is the true Gonyosoma prasinum? As no molecular data for the type specimens is available, we can only solve this problem through morphological characteristics. However, we cannot judge this problem from the original description (Blyth 1854) of G. prasinum as it is too short and not detailed enough. Since most of the subsequent descriptions and photographs (e.g., Boulenger 1894; Smith 1943; Schulz 1996; Cox et al. 1998; Zhao et al. 1998; Zhao 2006; Yang and Rao 2008; Das 2010, 2012; Shi et al. 2011; Purkayastha 2013; Qi 2019) of G. prasinum are either quoted from previous publications or based on specimens whose collection sites are distant from the type locality, these specimens may not be the true G. prasinum, so these data cannot be used here. We can only identify this species according to the descriptions and photographs (e.g., Das 2013; Khandekar et al. 2021) of specimens originating from its type locality and its vicinities.

Materials and methods

Sampling

Field surveys in Yunnan, China, were conducted under the permits of Xishuangbanna National Natural Reserve Management Bureau and Wuliangshang National Nature Reserve Management Bureau. Field survey in Northern Myanmar was undertaken at the invitation of the Republic of the Union of Myanmar, Ministry of Natural Resources and Environmental Conservation, Forest Department, Forest Research Institute. Four specimens (KIZ2019025–KIZ2019028) were collected from Mengla County, Yunnan Province, China, in April to May 2019, one specimen (KIZ20200729) was collected from Zhenyuan County, Yunnan Province, China, in July 2020, one specimen (KIZ20200903) was collected from Menglian County, Yunnan Province, China, in September 2020, and two specimens (SEABRI2019120043, SEABRI2019120075) were collected from Htamanthi wildlife sanctuary, Sagaing, Myanmar, in December 2019. Specimens were collected by hand, and photographs were taken to document color pattern in life prior to euthanasia. Liver tissues were stored in 99% ethanol and snakes were preserved in 75% ethanol. The specimens from China were deposited in Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ) and the specimens from Myanmar were deposited in Southeast Asia Biodiversity Research Institute, Chinese Academy of Sciences (SEABRI).

Molecular data and phylogenetic analyses

All species of the genus Gonyosoma were included in the study. Homologous sequences were obtained from GenBank. Six samples from China and two sample from Myanmar were incorporated in the analysis, and the new sequences have been deposited in GenBank. Elaphe taeniura (Cope) and Coelognathus radiatus (Boie) were used as outgroups. All the GenBank accession numbers for taxa used in this study were listed in Table 1.

Table 1.
Download as
CSV
XLSX

Sequences of cytb gene used in this study.

Species Voucher Locality Accession
Coelognathus radiatus CHS556 Wenshan, Yunnan, China MK201411
Elaphe taeniura CHS203 Xiangcheng, Sichuan, China MK201333
Gonyosoma boulengeri YPX11032 / AF471053
CHS242 Mengzi, Yunnan, China MK201360
CHS243 Hainan, China MK201361
Gonyosoma frenatum YPX11027 / KF669250
HS11038 / KF669251
EXTRACTION / KF669246
/ / DQ902110
CHS138 Huangshan, Anhui, China MK201289
CHS139 Huangshan, Anhui, China MK201290
Gonyosoma jansenii / Sulawesi DQ902113
KU 321724 Zamboanga, Mindanao, Philippines KC010343
Gonyosoma margaritatum / / KM870886
Gonyosoma oxycephalum / / AF471084
ROM 37622 / KX694870
Gonyosoma prasinum SEABRI2019120043 Htamanthi, Sagaing, Myanmar MZ322864
SEABRI2019120075 MZ322863
Gonyosoma coeruleum sp. nov. KIZ2019025 Mengla, Yunnan, China MZ322870
KIZ2019026 MZ322869
KIZ2019027 MZ322868
KIZ2019028 MZ322867
KIZ20200729 Zhenyuan, Yunnan, China MZ322866
KIZ20200904 Menglian, Yunnan, China MZ322865

DNA was extracted using DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. A fragment of mitochondrial cytochrome b (cytb) gene was amplified using the primer pair L14910: 5’–GACCTGTGATMTGAAAACCAYCGTT–3’ and H16064: 5’–CTTTGGTTTACAAGAACAATGCTTTA–3’ (Burbrink et al. 2000). PCR amplifications were performed in 25 μl reactions by using the following cycling conditions: initial denaturation for 120 s at 95 °C, followed by 35 cycles: denaturation at 94 °C for 40 s, annealing at 48.5 °C for 25 s, elongation at 72 °C for 15 s, and then finalized with elongation step of 120 s at 72 °C, with the PTC-100 thermal cycler (BioRad, USA). The products were purified by using the DNA Agarose Gel Extraction Kit (Omega, USA) according to the manufacturer’s instructions. Purified PCR products were sequenced using the same PCR primers. Sequencing was completed by Beijing Qingke New Industry Biotechnology Co., Ltd. Sequences were edited and manually managed using SeqMan in Lasergene 7.1 (DNASTAR Inc., Madison, WI, USA) and MEGA X (Kumar et al. 2018).

Sequences were aligned using ClustalX 2.0 (Thompson et al. 1997) with the default parameters. Pairwise distances between species were calculated in MEGA X (Kumar et al. 2018). The best substitution models HKY+F+I+G4 and GTR+F+I+G4 were selected for Bayesian inference and Maximum Likelihood analysis, respectively, using the Akaike Information Criterion (AIC) in ModelFinder (Kalyaanamoorthy et al. 2017). Bayesian inference was performed in MrBayes 3.2.7 (Ronquist et al. 2012). Two runs were performed simultaneously with four Markov chains starting from random tree. The chains were run for 10,000,000 generations and sampled every 1000 generations. The first 25% of the sampled trees was discarded as burn-in after the standard deviation of split frequencies of the two runs was less than a value of 0.01, and then the remaining trees were used to create a 50% majority-rule consensus tree and to estimate Bayesian posterior probabilities. Maximum Likelihood analysis was performed in RaxmlGUI 2.0 (Silvestro and Michalak 2012), nodal support was estimated by 1,000 rapid bootstrap replicates.

Morphology

Body and tail lengths were measured with a ruler to the nearest 1 mm (Jablonski et al. 2019). Scale counts were taken following Janssen et al. (2019). Ventral scales were counted according to Dowling (1951). Bilateral scale counts were given as left / right order. Abbreviations of morphological characters are as follows: Atem, number of anterior temporals; DSR, dorsal scale rows number at one head length posterior to the head – number of dorsal scale rows at midbody – number of dorsal scale rows at one head length anterior to the vent, respectively; IL, infralabials (counted on lower lips); Lor, loreals; Lor / eye, loreal scale touching the eye (yes or no); PostOc, postoculars; Prec, precloacal plate (corresponds to term anal plate in older literature) (single or divided); PreOc, preoculars; PTem, number of posterior temporals; SL, supralabials (counted on upper lips); SL / orbit, number of supralabials entering orbit; SubC, number of subcaudal scales; SVL, snout-vent length (from tip of snout to vent); TaL, tail length; TaL / TL, ratio of tail length / total length; TL, total length; Ven, number of ventral scales.

Results

The topologies derived from Bayesian inference and Maximum Likelihood analysis were consistent (Fig. 1). The sequences of the specimens from China formed a separate clade sister to the sequences of the specimens from Myanmar, however, the nodal supports were low. The average uncorrected pairwise distance (p-distance) between the sequences of the specimens from China and the sequences of the specimens from Myanmar is 11.78%. (Table 2).

Table 2.
Download as
CSV
XLSX

Average uncorrected p-distances (%) between members of Gonyosoma and outgroups calculated from cytb gene sequences.

1 2 3 4 5 6 7 8
1 Gonyosoma coeruleum sp. nov.
2 Gonyosoma boulengeri 13.01
3 Gonyosoma frenatum 13.35 7.56
4 Gonyosoma jansenii 17.07 15.63 16.88
5 Gonyosoma margaritatum 12.33 12.51 12.41 16.91
6 Gonyosoma oxycephalum 15.77 15.32 16.36 7.75 15.98
7 Gonyosoma prasinum 11.78 12.89 12.65 17.69 12.71 15.96
8 Coelognathus radiatus 19.32 18.40 18.15 19.49 18.97 19.66 17.35
9 Elaphe taeniura 16.27 15.56 15.59 16.21 16.07 16.92 16.32 15.90

Morphological measurements, scale counts and colorations in life were presented in Table 3. The coloration of the iris of the specimens from Myanmar and from China in life are obviously different, the coloration of the iris of the specimens from Myanmar in life is greenish yellow (Figs 4B, 5C, D) while the colorations of the iris of the specimens from China are blue (Figs 4A, 5A, B). Besides this difference, the precloacal plates of the specimens from Myanmar are single (Fig. 4F) while the precloacal plates of the specimens from China are divided (Fig. 4E). According to the photographs (Khandekar et al. 2021) of Gonyosoma prasinum in life from the type locality and the vicinities of the type locality, the colorations of the iris are all greenish-yellow. In addition, according to the description of Gonyosoma prasinum based on a specimen from Namchik, Arunachal Pradesh (Das 2013), which is close to the type locality, the precloacal plate is single. Therefore, we consider the specimens from Myanmar to be conspecific with the true G. prasinum and the specimens from China to belong to a new species.

Figure 1.

The consistent phylogram inferred from Bayesian Inference and Maximum Likelihood analyses based on cytb gene sequences. Numbers before slashes indicate Bayesian posterior probabilities (values below 0.9 were not shown) and numbers after slashes indicate bootstrap support for Maximum Likelihood analyses (values below 60 were not shown).

Table 3.
Download as
CSV
XLSX

Measurements (in mm), scalation data, and coloration of Gonyosoma coeruleum sp. nov. and G. prasinum. For abbreviations see Materials and methods.

Gonyosoma coeruleum sp. nov. Gonyosom prasinum
KIZ2019028 Holotype KIZ2019025 Paratype KIZ2019026 Paratype KIZ2019027 Paratype KIZ20200729 Paratype KIZ20200904 Paratype SEABRI2019120043 SEABRI2019120075
Sex Female Female Male Male Female Juvenile Male Male
SVL 814 656 833 719 696 388 487 577
TL 1058 863 974+ 992 918 511 656 779
TaL 245 207 141+ 273 222 123 169 202
TaL / TL 0.23 0.24 0.14+ 0.28 0.24 0.24 0.26 0.26
SL 8/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9
SL / orbit 3-5/4-6 4-6 4–6 4–6 4–6 4–6 4–6 4–6
IL 10/10 10/10 10/10 10/10 11/10 10/10 11/10 10/10
PreOc 1/1 1/1 1/1 1/1 1/1 1/1 1/1 1/1
PostOc 2/2 2/2 2/2 2/2 2/2 2/2 2/2 2/2
Lor 1/1 1/1 1/1 1/1 1/1 1/1 1/1 1/1
Lor / eye no No no no no no no no
Atem 2/2 2/2 2/2 1/1 1/2 1/1 1/1 1/2
PTem 2/2 3/2 2/2 2/2 2/2 2/2 1/1 2/2
DSR 19-19-15 19-19-15 19-19-15 19-19-15 19-19-15 19-19-15 19-19-13 19-19-15
Ven 202 199 196 190 189 195 194 193
SubC 89 103 44+ 106 93 105 104 105
Prec Divided Divided Divided Divided Divided Divided Single Single
Body color Green Green Green Green Green Green Green Green
Tongue color Brownish yellow Brownish yellow Brownish yellow Brownish yellow Brownish yellow Brownish yellow Brownish yellow Brownish yellow
Inside of mouth Greyish white Greyish white Greyish white Greyish white Greyish white Greyish white Pink Pink
Iris color Blue Blue Blue Blue Blue Blue Greenish yellow Greenish yellow

Gonyosoma coeruleum sp. nov.

http://zoobank.org/81045CF9-665A-4E9C-A563-4794208D0A40
Figs 2, 3, 4A, C, E, 5A, B, 7B

Holotype

KIZ2019028, adult female, Mengla County, Xishuangbanna Autonomous Prefecture, Yunnan Province, China, 29 April 2019, 21°32'12"N, 101°32'51"E, 900 m a.s.l.

Paratypes

KIZ2019025, one adult female and KIZ2019026–KIZ2019027, two adult males, Mengla County, Xishuangbanna Autonomous Prefecture, Yunnan Province, China, 4 May 2019, 21°55'9"N, 101°32'12"E, 890 m, a.s.l. KIZ20200729, adult female, collected from Zhenyuan County, Puer City, Yunnan Province, China, 29 July 2020, 24°3'37"N, 101°3'43"E, 1,240 m a.s.l. KIZ20200904, one juvenile, collected from Menglian County, Puer City, Yunnan Province, China, 3 September 2020, 22°10'16"N, 99°18'31"E,1,200 m a.s.l.

Etymology

The specific epithet “coeruleum” is the neutral gender of the Latin adjective coeruleus (a, um) meaning “blue”, and is given in reference to the coloration of the iris of this species.

Diagnosis

Body size medium (SVL 656–833mm in adults); body slender, head elongated and distinct from neck; large eyes with round pupil; tail long (23–28% of total length) and slender; dorsal scales in 19-19-15 rows, 7–11 rows of mid-dorsal scales keeled; single preocular; two postoculars; one or two anterior temporals and two or three posterior temporals; 189–202 ventral scales; 89–106 paired subcaudals; precloacal plate divided. Dorsal surface bright green with brownish-yellow tip of tail, iris blue, inside of mouth greyish white; tongue brownish yellow with black tips.

Figure 2.

Type series of Gonyosoma coeruleum sp. nov. in preservative. A dorsal view B ventral view.

Description of the holotype

Head elongate, distinct from the neck, flattened, longer than wide, narrowed anteriorly; nostril lateral; eye large, pupils round; rostral triangular, broader than high, visible from above; nasal divided into two scales; two internasals, wider than high, bordered by two large prefrontals posteriorly; frontal single, enlarged, pentagonal, narrowed posteriorly; parietals longer than wide, in contact with each other; supralabials 8/9, first and second in contact with the prenasal and postnasal, third and fourth entering orbit on left side, fourth and sixth entering orbit on right side, eighth largest; infralabials 10/10, first pair in broad contact with each other, first to fifth in contact with anterior pair of chin shields; anterior and posterior pairs of chin shields elongate, second pair meeting in midline; preocular 1/1; postoculars 2/2, lower ones smaller, bordering anterior temporals; anterior temporals 2/2, posterior temporals 2/2. SVL 814 mm; TaL 245 mm; TaL/TL 0.23; DSR 19-19-15, nine rows keeled in the vertebral region, otherwise smooth; ventrals 202 with a lateral keel; subcaudals 89, paired; precloacal plate divided.

Figure 3.

Head views of the holotype (KIZ2019028) of Gonyosoma coeruleum sp. nov. in preservative. A dorsal B ventral C right D left.

Color of holotype in life

Dorsal surface bright green with brownish-yellow tip of tail, reticulate pattern consisting of yellow, black, and white on the interstitial skin; upper lips yellowish-green; anterior ventral surface greenish-white and posterior ventral surface light green; tip of tail brownish-yellow on its ventral surface; ventrals outside the lateral keel usually yellowish-white; iris blue; pale grey inside of mouth; tongue brownish-yellow with black tips.

Figure 4.

Comparisons of the colors of iris, the colors of inside of mouth, and the precloacal plates. A, C, and E the holotype (KIZ2019028) of Gonyosoma coeruleum sp. nov. B, D, and F the specimen (SEABRI2019120043) of G. prasinum.

Variations

The paratypes resemble the holotype in most aspects except that the rows of mid-dorsal scales keeled vary from seven to eleven, anterior temporals vary from one to two, and posterior temporals vary from two to three in paratypes; moreover, the male paratype KIZ2019027 has a relatively longer tail (TaL/TL 0.28).

Figure 5.

The specimens of Gonyosoma coeruleum sp. nov. and G. prasinum in life. A the female paratype (KIZ20200729) of Gonyosoma coeruleum sp. nov. B the juvenile paratype (KIZ20200904) of Gonyosoma coeruleum sp. nov. C the specimen (SEABRI2019120043) of G. prasinum from Myanmar D the specimen (SEABRI2019120075) of G. prasinum from Myanmar.

Distribution

Gonyosoma coeruleum sp. nov. is currently known from Xishuangbanna Autonomous Prefecture and Puer City, Yunnan Province, China (Fig. 6), it is probably also distributed in other parts of Yunnan Province and Sichuan, Guizhou, and Hainan Province, China, as well as Southern Myanmar, Thailand, Laos, and Vietnam.

Figure 6.

Map showing the type locality of Gonyosoma coeruleum sp. nov. (blue star) in Mengla County, Yunnan Province, China; the other collection sites of Gonyosoma coeruleum sp. nov. in Zhenyuan County (blue pentagon) and Menglian County (blue triangle), Yunnan Province, China; the type locality (green square) of G. prasinum in Assam, India; and the new collection site (green dot) of G. prasinum in Htamanthi wildlife sanctuary, Sagaing, Myanmar.

Natural history

The specimens from Mengla County were collected on big trees bordering rivers, the specimen from Zhenyuan County was collected on a big tree on the side of a small road in forest, and the specimen from Menglian County was collected on a small tree bordering a stream. All specimens were found at night while they were asleep on tree branches, what shows that this species is diurnal. Through direct observation, we found that they like to feed on small rodents, and whether they also prey on other animals is unknown.

Comparisons

Gonyosoma coeruleum sp. nov. can be distinguished from G. boulengeri in lacking a nasal appendage (vs. rostral distinct from the nasal appendage), and no dark stripe behind the eye (vs. an indistinct dark stripe behind the eye) (Mocquard 1897; Smith 1943).

Gonyosoma coeruleum sp. nov. is distinguishable from G. frenatum based on its single, distinct loreal (vs. loreal united with the prefrontal), and no black streak along the side of the head (vs. a black streak along the side of the head above the supralabials) (Gray 1853; Boulenger 1894; Smith 1943).

Gonyosoma coeruleum sp. nov. can be separated from G. jansenii by having 19 midbody dorsal scale rows (vs. 23–25), and dorsal surface uniform bright green with brownish-yellow tip of tail (vs. olive or yellowish-brown, entirely black posteriorly and on the tail) (Bleeker 1859; Boulenger 1894).

From Gonyosoma margaritatum, Gonyosoma coeruleum sp. nov. can be differentiated by its dorsal surface uniform bright green with brownish-yellow tip of tail (vs. black, each scale with a yellowish green spot, or green with black borders to the scales, hinder part of body and tail with bright orange rings), and no black streak on each side of the head (vs. a black streak on each side of the head behind the eye) (Peters 1871; Boulenger 1894).

Figure 7.

A habitat at the type locality of Gonyosoma coeruleum sp. nov. B Gonyosoma coeruleum sp. nov. asleep on a tree at night.

From Gonyosoma oxycephalum, Gonyosoma coeruleum sp. nov. can be differentiated by the different colors of tail (green with brownish-yellow tip vs. the whole tail light chestnut or buff-red or yellowish brown), no blackish stripe along the side of the head (vs. an indistinct blackish stripe along the side of the head immediately above the supralabials), and the number of midbody dorsal scale, 19 rows (vs. 23–27 rows) (Boie 1827; Boulenger 1894; Smith 1943).

Gonyosoma coeruleum sp. nov. closely resembles G. prasinum, but the colorations of their iris in life are obviously different, the iris of Gonyosoma coeruleum sp. nov. is blue (Fig. 4A) while the iris of G. prasinum is greenish-yellow (Fig. 4B; Khandekar et al. 2021). The colours of the inside of mouth are slightly different, the inside of mouth of Gonyosoma coeruleum sp. nov. is pale grey (Fig. 4C) while it is pink (Fig. 4D) in G. prasinum. In addition, the precloacal plate of Gonyosoma coeruleum sp. nov. is divided (Fig. 4E) while it is single (Fig. 4F; Das 2013) in G. prasinum.

Discussion

One type specimen of Gonyosoma prasinum is currently available in the Natural History Museum, London (BMNH 1946.1.10.22). We have tried to check the type specimen but failed due to the pandemic circumstances. However, we collected two specimens from northwestern Myanmar, where relatively close to the type locality, and these two specimens agree with the descriptions and photographs (Das 2013; Khandekar et al. 2021) of G. prasinum from the type locality and its vicinities, therefore we can confirm that the specimens from northwestern Myanmar belongs to G. prasinum.

Although there is no major difference in scalation between the new species and Gonyosoma prasinum in morphological characters, however, the colorations of the iris of them in life are obviously different. As, furthermore, the new species and G. prasinum have a large genetic divergence, they therefore deserve distinct a distinct status at species level.

Previously, Gonyosoma prasinum has been recorded in India, Bhutan, Myanmar, Thailand, Malaysia, Laos, Vietnam, and China (Wangyal et al. 2020; Uetz et al. 2021), and within China, it was recorded from Yunnan, Guizhou, Sichuan, and Hainan Provinces (Zhao et al. 1998; Wu et al. 2002; Zhao 2006; Yang and Rao 2008; Shi et al. 2011). However, we speculate that G. prasinum is only distributed in India, Bhutan, northern Myanmar, and Southeastern Tibet, China. Based on the photographs (eg. Vogel and Pauwels 2004; Pauwels et al. 2006; Zhao 2006; Ziegler et al. 2007; Yang and Rao 2008; Shi et al. 2011; Hecht et al. 2013; Pham et al. 2014; Qi 2019; Luu et al. 2020; Nguyen et al. 2020; and unpublished data) of snakes previously identified as G. prasinum from other parts of Yunnan Province, and Sichuan, Guizhou, and Hainan Province, China, Thailand, Laos, and Vietnam, through the coloration of the iris, we speculate that these populations also belong to Gonyosoma coeruleum sp. nov. For the populations distributed in Malaysia, as we do not have specimens and photographs, whether they also belong to Gonyosoma coeruleum sp. nov. is still unknown.

Gonyosoma coeruleum sp. nov. is a familiar species in southern Yunnan, China, however, we observed that Gonyosoma coeruleum sp. nov. was often captured and traded as pets due to its beautiful appearance. In order to protect this beautiful species, we suggest that this species to be added to the local protected animal lists and be banned from pet trading.

Acknowledgements

The field survey in Myanmar was undertaken at the invitation of the Republic of the Union of Myanmar, Ministry of Natural Resources and Environmental Conservation, Forest Department, Forest Research Institute. We thank them for the invitation. Thanks also to the staff and the local guides of Myanmar for their help in the field. This work was supported by Science-Technology Basic Condition Platform from the Ministry of Science and Technology of the People’s Republic of China (Grant No. 2005DKA21402), the project of the second comprehensive scientific investigation of Xishuangbanna National Nature Reserve, and the project of Ministry of Ecology and Environment of China: Investigation and assessment of amphibians and reptiles in Jinghong City, Menghai County, and Mengla County.

References

  • Bleeker P (1859) Gonyosoma jansenii Blkr., eene nieuwe slang van Manado. Natuurkundig Tijdschrift voor Nederlandsch Indië 16(4): e242.
  • Blyth E (1854) Notices and descriptions of various reptiles, new or little known, Part 2. Journal of the Asiatic Society of Bengal 23(3): 287–302.
  • Boulenger GA (1894) Catalogue of the snakes in the British Museum (Natural History). Volume II., containing the conclusion of the Colubridæ Aglyphæ. British Museum Natural History, London, 382 pp.
  • Burbrink FT, Lawson R, Slowinski JB (2000) Mitochondrial DNA phylogeography of the polytypic North American rat snake (Elaphe obsoleta): a critique of the subspecies concept. Evolution 54: 2107–2118. https://doi.org/10.1111/j.0014-3820.2000.tb01253.x
  • Chen X, Lemmon AR, Lemmon EM, Pyron AR, Burbrink FT (2017) Using phylogenomics to understand the link between biogeographic origins and regional diversification in ratsnakes. Molecular Phylogenetics and Evolution 111: 206–218. https://doi.org/10.1016/j.ympev.2017.03.017
  • Chen X, McKelvy AD, Grismer LL, Matsui M, Nishikawa K, Burbrink FT (2014) The phylogenetic position and taxonomic status of the Rainbow Tree Snake Gonyophis margaritatus (Peters, 1871) (Squamata: Colubridae). Zootaxa 3881(6): 532–48. http://dx.doi.org/10.11646/zootaxa.3881.6.3
  • Cox MJ, van Dijk PP, Nabhitabhata J, Thirakhupt K (1998) A Photographic Guide to Snakes and Other Reptiles of Thailand and Southeast Asia. Asia Books, Bangkok, 144 pp.
  • Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: 772–772. https://doi.org/10.1038/nmeth.2109
  • Das I (2002) A Photographic Guide to Snakes and other Reptiles of India. New Holland Publishers, London, 144 pp.
  • Das I (2010) A Field Guide to the Reptiles of South-East Asia. New Holland Publishers, London, 376 pp.
  • Das I (2012) A Naturalist’s Guide to the Snakes of South-East Asia – Malaysia, Singapore, Thailand, Myanmar, Borneo, Sumatra, Java and Bali. John Beaufoy Publishing, Oxford, 160 pp.
  • Das A (2013) Notes on ratsnakes from north-eastern India. In: Schulz K-D (Eds) Old World ratsnakes – A collection of papers. Bushmaster Publications, Würselen, 309–336.
  • Dowling HG (1951) A proposed standard system of counting ventral in snakes. Journal of Herpetology 1(5): 97–99.
  • Gray JE (1853) Descriptions of some undescribed species of reptiles collected by Dr. Joseph Hooker in the Khassia Mountains, East Bengal, and Sikkim Himalaya. Annals and Magazine of Natural History (2), 12(72): 386–392. https://doi.org/10.1080/03745485709495063
  • Hecht VL, Pham CT, Nguyen TT, Nguyen TQ, Bonkowski M, Ziegler T (2013) First report on the herpetofauna of Tay Yen Tu Nature Reserve, northeastern Vietnam. Biodiversity Journal 4(4): 507–552.
  • Jablonski D, Kukushkin OV, Avcı A, Bunyatova S, Kumlutaş Y, Ilgaz Ç, Polyakova E, Shiryaev K, Tuniyev B, Jandzik D (2019) The biogeography of Elaphe sauromates (Pallas, 1814), with a description of a new rat snake species. PeerJ 7: e6944. https://doi.org/10.7717/peerj.6944
  • Janssen HY, Pham CT, Ngo HT, Le MD, Nguyen TQ, Ziegler T (2019) A new species of Lycodon Boie, 1826 (Serpentes, Colubridae) from northern Vietnam. ZooKeys 875: 1–29. https://doi.org/10.3897/zookeys.875.35933
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Luu VQ, Dinh TS, Lo OV, Nguyen TQ, Ziegler T (2020) New records and an updated list of reptiles from Ba Vi National Park, Vietnam. Bonn zoological Bulletin 69(1): 1–9.
  • Nguyen TV, Brakels P, Maury N, Sudavanh S, Pawangkhanant P, Idiiatullina S, Lorphengsy S, Inkhavilay K, Suwannapoom C, Poyarkov NA (2020) New herpetofaunal observations from Laos based on photo records. Amphibian & Reptile Conservation 14(2): 218–249.
  • Pauwels OSG, Droz B, Vogel G (2006) Elaphe prasina (Blyth, 1854) in Thailand. Elaphe 14(4): e62.
  • Peters W (1871) Über neue Reptilien aus Ostafrika und Sarawak (Borneo), vorzüglich aus der Sammlung des Hrn. Marquis J. Doria zu Genua. Monatsberichte der Königlichen Preussische Akademie Des Wissenschaften zu Berlin 1871: 566–581.
  • Pham AV, Nguyen SLH, Nguyen TQ (2014) New records of snakes (Squamata: Serpentes) from Son La Province, Vietnam. Herpetology Notes 7: 771–777.
  • Purkayastha J (2013) An Amateur’s Guide to Reptiles of Assam. EBH Publishers, Guwahati, 146 pp.
  • Qi S (2019) A photographic guide to reptiles of China. Chongqing University Press, Chongqing, 236 pp.
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Schulz K-D (1996) A monograph of the colubrid snakes of the genus Elaphe Fitzinger. Koeltz Scientific Books, Havlickuv Brod, 439 pp.
  • Schulz K-D (1991) Die hinterasiatischen kletternattern der Gattung Elaphe Teil XX Elaphe prasina (Blyth 1854) und Elaphe frenata (Gray 1853). Sauria 13(2): 15–17.
  • Shi HT, Zhao EM, Wang LJ, Bi H, Lyu SQ, Liu HN, Wang JC, Zhao H, Hong ML (2011) Amphibian and Reptile Fauna of Hainan. Science Press, Beijing, 285 pp.
  • Smith MA (1943) The fauna of British India, Ceylon and Burma, including the whole of the Indo-chinese subregion. Reptilia and Amphibia (Vol. III). Serpentes. Taylor and Francis, London, 583 pp.
  • Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The ClustalX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25: 4876–4882. https://doi.org/10.1093/nar/25.24.4876
  • Vogel G, Pauwels OSG (2004) Geographic distribution. Elaphe prasina (Green Bush Rat Snake). Herpetological Review 35(4): e410.
  • Wangyal JT, Bower DS, Sherub, Tshewang S, Wangdi D, Rinchen K, Phuntsho S, Tashi C, Koirala BK, Gyeltshen, Bhandari GS, Jamtsho S, Phuntsho Y, Koirala TP, Ghalley BB, Chaida L, Tenzin J, Powrel RB, Tshewang R, Raika ON, Jamtsho S, Kinley, Gyeltshen, Tashi S, Nidup D, Wanfdi N, Phuentsho, Norbu L, Wangdi K, Wangchuk T, Tobgay P, Dorji T, Das I (2020) New Herpetofaunal Records from the Kingdom of Bhutan Obtained through Citizen Science. Herpetological Review 51(4): 790–798.
  • Wu GJ, Wu TH, Zhu J, Xiao L (2002) A new record of snake species in Sichuan Province – Elaphe prasina. Sichuan Journal of Zoology 21(2): 66.
  • Yang DT, Rao DQ (2008) Amphibia and Reptilia of Yunnan. Yunnan Publishing Group Corporation, Yunnan Science and Technology Press, Kunming, 411 pp.
  • Zhao EM (2006) Snakes of China. Anhui Science Technology Publishing House, Hefei, 669 pp.
  • Zhao EM, Huang MH, Zong Y, Jiang YM, Huang QY, Zhao H, Ma JF, Zheng J, Huang ZJ, Wei G, Yang DQ, Li DJ (1998) Fauna Sinica Reptilia, vol. 3: Squamata: Serpentes. Science Press, Beijing, 522 pp.
  • Ziegler T, Hendrix R, Vu TN, Vogt M, Forster B, Dang KN (2007) The diversity of a snake community in a karst forest ecosystem in the central Truong Son, Vietnam, with an identification key. Zootaxa 1493: 1–40. https://doi.org/10.11646/zootaxa.1493.1.1
login to comment